Table 2.
Fluorescent probes used in this study.
| Probe | Target | Sequence (5′-3′) | Fluorescein | Formamide (%) |
|---|---|---|---|---|
| EUB338 | Bacteria | GCTGCCTCCCGTAGGAGT | 5′Cy3 | 25 |
| Lkb | L. kefiranofaciens | CCACCGCTACACATGGAGTTCTAC | 5′FITH | 25 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.