Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Zmynd10 | NA | MGI:2387863; ENSMUSG00000010044; |
Synonym: Blu; Dnaaf7 |
| Strain (M. musculus) | C57BL/6J | JAX | 664 | |
| Strain (M. musculus) | C3H/HeJ | JAX | 659 | |
| Strain (M. musculus) | CD1 (ICR) | Charles River | 022 | Outbred background |
| Genetic reagent (M. musculus) |
Zmynd10em1Pmi | This paper | Allele symbol: Zmynd10em1Pmi; Allele synonym: Zmynd10-; Accession ID: MGI:6159883 |
CRISPR null allele of Zmynd10;
Zmynd10 c.695_701 p.Met178Ilefs*183 |
| Cell line (H. sapiens) | HEK293 | ATCC | CRL-1573 | Human embryonic kidney cell line. |
| Cell line (H. sapiens) | RPE-1 | ATCC | CRL-4000 | Human retinal pigmented epithelial cell line immortalized with hTERT. |
| Biological sample (M. musculus) |
mouse tracheal epithelial cells (mTECs) |
This paper | NA | See Vladar and Brody, 2013
for protocol. |
| Biological sample (H. sapiens) |
MucilAir tracheal epithelial cell cultures |
Epithelix Sarl | EP01MD | |
| Antibody | Acetylated α-tubulin | Sigma | 6-11B-1; T6793, RRID:AB_477585 |
IF (1:500–2000) |
| Antibody | β-actin | Sigma | AC-15; A1978, RRID:AB_476692 |
WB (1:1000) |
| Antibody | DNAAF1/LRRC50 | Novus Biologicals | NBP2-01936; RRID: AB_2732031 |
WB (1:5000) |
| Antibody | DNAH5 | PMID: 23525783 | Custom made | IF (1:100), PLA; WB (1:5000) |
| Antibody | DNAH5 | Sigma | HPA037470, RRID:AB_10672348 |
IF (1:100), PLA; WB (1:5000) |
| Antibody | DNAH9 | PMID: 24421334 | Custom made | IF (1:100), PLA; WB (1:5000) |
| Antibody | DNAH5 | Sigma | HPA037470, RRID:AB_10672348 |
WB (1:5000) |
| Antibody | DNAI1 | Abcam | ab171964; RRID: AB_2732030 |
WB (1:5000) |
| Antibody | DNAI2 | Abnova | M01 clone IC8; H00064446-M01, RRID:AB_426059 |
IF (1:100), PLA; WB (1:5000) |
| Antibody | DNAI2 | Proteintech | 17533–1-AP; 17533–1-AP, RRID:AB_2096670 |
IF (1:100); WB (1:5000); IP (1.5 μg-3μg/IP) |
| Antibody | DNALI1 | Santa Cruz | N-13; sc-160296, RRID:AB_2246230 |
IF (1:75); WB (1:1000) |
| Antibody | FKBP8 | Proteintech | 11173–1-AP, RRID:AB_10597097 |
WB (1:5000); IP (1.5 μg-3μg/IP) |
| Antibody | FKBP8 | R and D Systems | MAB3580, RRID:AB_2262675 |
WB (1:5000) |
| Antibody | γ tubulin | Abcam | GTU-88; ab11316, RRID:AB_297920 |
IF (1:500) |
| Antibody | GAPDH | Abcam | ab8245, RRID:AB_2107448 |
WB (1:5000) |
| Antibody | tGFP | Origene | TA150041, RRID:AB_2622256 |
IF (1:200); WB (1:5000) |
| Antibody | GFP | Santa Cruz | FL; sc-8334, RRID:AB_641123 |
WB (1:5000); IP (1.5 μg-3μg/IP) |
| Antibody | GRP-94/HSP90B1 | Thermo Scientific | clone 9G10; MA3-016, RRID:AB_2248666 |
IF (1:100); WB (1:5000) |
| Antibody | HSP70 | Santa Cruz | K-20; sc-1060, RRID:AB_631685 |
WB (1:5000) |
| Antibody | HSP90AB1 | R and D Systems | MAB32861, RRID:AB_2121071 |
WB (1:5000) |
| Antibody | HSP90 | Santa Cruz | Clone F-8; sc-13119, RRID:AB_675659 |
WB (1:5000) |
| Antibody | LRRC6 (Hiroshi Hamada) | PMID:27353389 | Custom made | WB (1:5000), a gift from Hiroshi Hamada |
| Antibody | SENTAN | Sigma | HPA043322 , RRID: AB_10793945 |
IF (1:150) |
| Antibody | ZMYND10 | Proteintech | 14431–1-AP, RRID:AB_2218002 |
WB (1:5000); IF (1:100); IP (1.5 μg-3μg/IP) |
| Antibody | ZMYND10 | Sigma | HPA035255, RRID:AB_10601928 |
WB (1:5000); IF (1:100); IP (1.5 μg-3μg/IP) |
| Recombinant DNA reagent |
pCMV6-Zmynd10-tGFP | Origene | MG207003 | Mouse Zmynd10 ORF with C-terminal turbo-GFP tag under CMV promoter in plasmid with ampicillin resistance gene |
| Recombinant DNA reagent |
pCMV6-DNAAF5-tGFP | Origene | MR221395 | Mouse Dnaaf5 ORF with C-terminal turbo-GFP tag under CMV promoter in plasmid with ampicillin resistance gene |
| Recombinant DNA reagent |
pRK5-Myc-LRRC6 | PMID:23891469 | NA | Human LRRC6 ORF with myc tag; gift from the Hildebrandt and Gee labs |
| Recombinant DNA reagent |
pX330-U6-Chimeric
_BB-CBh-hSpCas9 |
PMID: 23287718 | Addgene:#42230 | A human codon-optimized SpCas9 and chimeric guide RNA expression plasmid. pX330-U6-Chimeric_BB-CBh-hSpCas9 was a gift from Feng Zhang. |
| Recombinant DNA reagent |
pCAG-EGxxFP | PMID: 24284873 | Addgene:#50716 | 5’ and 3’ EGFP fragments that shares 482 bp were placed under ubiquitous CAG promoter. Used for validation of gRNA sequences by DSB mediated EGFP reconstitution. pCAG-EGxxFP was a gift from Masahito Ikawa |
| Sequence-based reagent |
mouse Dnahc5
qRT-PCR primers |
This paper | AAGCTGTTGCACCAGACCAT/ CCCAGGTGGCAGTTCTGTAG; Probe:88 |
|
| Sequence-based reagent |
mouse Dnali1
qRT-PCR primers |
This paper | AGTTCCTGAAACGGACCAAC/ TGAGACCCATGTGGAAATGA; Probe:97 |
|
| Ssequence-based reagent |
mouse Zmynd10
qRT-PCR primers |
This paper | GCCATCCTTGATGCAACTATC/ CAATCAGCTCCTCCACCAG; Probe:64 |
|
| Sequence-based reagent |
mouse Tbp
qRT-PCR primers |
This paper | GGGGAGCTGTGATGTGAAGT/ CCAGGAAATAATTCTGGCTCA; Probe:97 |
|
| Chemical compound, drug |
N-(N’N’-Dimethyl carboxamidomethyl) cycloheximide (DM-CHX) |
PMID:16547004 | FKBP8 inhibitor, 1 mM stock in sterile PBS | |
| Software, algorithm |
Fiji | PMID: 22743772 | ||
| Software, algorithm |
Nis-Elements AR V4.6 | Nikon Instruments | ||
| Software, algorithm |
Imaris V9.1 | Bitplane | ||
| Software, algorithm |
MaxQuant | PMID: 19029910 | ||
| Software, algorithm |
Andromeda | PMID: 21254760 | ||
| Software, algorithm |
Perseus | PMID: 27348712 | ||
| Software, algorithm |
Crapome | PMID: 23921808 |