REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
anti-CD45.1 (clone A20)	Biolegend	Cat# 110724
anti-CD45.2 (clone 104)	Biolegend	Cat# 109824
anti-CD3 (clone 17A2)	Biolegend	Cat# 100214
anti-CD4 (clone GK1.5)	Biolegend	Cat# 100422
anti-CD8 (clone 53-6.7)	Biolegend	Cat# 100730
anti-CD25 (clone PC61)	Biolegend	Cat# 102026
anti-KLRG1 (clone 2F1/KLRG1)	Biolegend	Cat# 138416
anti-CD69 (clone H1.2F3)	Biolegend	Cat# 104539
anti-CXCR3 (clone CXCR3-173)	Biolegend	Cat# 126512
anti-TCR Vα2 (clone B20.1)	Biolegend	Cat# 127806
anti-CD45 (clone 30-F11)	Biolegend	Cat# 103126
anti-CD11b (clone M1/70)	Biolegend	Cat# 101230
anti-CD11c (clone N418)	Biolegend	Cat# 117310
anti-F4/80 (clone BM8)	Biolegend	Cat# 123114
anti-ARTC2 (Treg-Protector, clone S+16a)	Biolegend	Cat# 149802
anti- IFN-γ (clone XMG1.2)	Biolegend	Cat# 505826
anti-ST2 (clone RMST2-2)	eBioscience	Cat# 46-9335-80
anti-Foxp3 (clone FJK-16s)	eBioscience	Cat# 17-5773-82
anti-Gata3 (clone TWAJ)	eBioscience	Cat# 12-9966-42
anti-TCR Vβ4 (clone KT4)	BD Biosciences	Cat# 553366
anti-Thy1.1 (clone OX-7)	BD Biosciences	Cat# 561409
anti-Thy1.2 (clone 53-2.1)	BD Biosciences	Cat#561641
anti-ki67 (clone B56)	BD Biosciences	Cat#561277
anti-Siglec-F (clone E50-2440)	BD Biosciences	Cat# 562068
anti-mouse MHC Class II (clone M5/114)	BioXCell	Cat# BE0108
rat IgG2b isotype control (clone LTF-2)	BioXCell	Cat# BE0090
anti-IL-33	R&D Systems	Cat# AF3626
Goat IgG	R&D Systems	Cat# AB-108-C
Donkey anti-goat Cy3	Jackson Immunoresearch	Cat# 705-165-147
Bacterial and Virus Strains
Biological Samples
Chemicals, Peptides, and Recombinant Proteins
Recombinant murine IL-2	Peprotech	Cat# 212-12
Carrier-free recombinant mouse IL-33	Biolegend	Cat# 580506
BrdU	Sigma	Cat# B5002
D-Glucose	Thermo Fisher SCIENTICIFC	Cat# D16-500
Insulin	Eli Lilly	Humulin R U-100
Collagenase type II	Sigma	Cat# C6885
Collagenase type IV	Gibco	Cat#17104019
DNase I	Sigma	Cat# DN25
2-Mercaptoethanol	Sigma	Cat# M7522
Critical Commercial Assays
Foxp3 / Transcription Factor Staining Buffer Set	eBioscience	Cat# 00-5523-00
True-Nuclear Transcription Factor buffer set	Biolegend	Cat# 424401
APC BrdU Flow Kit	BD Biosciences	Cat# 552598
gBlocks Gene Fragment Customize Synthesis	Integrated DNA Technologies	N/A
Treg-Protector	Biolegend	Cat# 149802
Percoll	GE Healthcare	Cat# 17089109
Buffer TCL	Qiagen	Cat# 1031576
OptiPrep Density Gradient Medium	Sigma	Cat# D1556
Ultra Sensitive Mouse Insulin ELISA Kit	Crystal Chem	Cat# 90080
Nextera DNA Sample Prep Kit	Illumina	Cat# FC-121-1030
HiScribe T7 High Yield RNA Synthesis Kit	NEB	Cat# E2040S
SuperScript™ III Reverse Transcriptase	Invitrogen	Cat# 18080093
Magnesium RNA fragmentation kit	Ambion	Cat# AM8740
PrimeScript Reverse Transcriptase	Takara Clontech	Cat# 2680B
RNAClean XP beads	Beckman Coulter	Cat# A63987
Kapa 2× HiFi HotStart PCR mix	Kapa Biosystems	Cat# KK2601
TransIT®-293 Transfection Reagent	Mirus	Cat# MIR 2705
RNeasy Lipid Tissue Mini Kit	Qiagen	Cat# 74804
Dynabeads™ Untouched™ Mouse CD4 Cells Kit	Thermo Fisher SCIENTICIFC	Cat# 11415D
Dynabeads™ Mouse T-Activator CD3/CD28 for T-Cell Expansion and Activation	Thermo Fisher SCIENTICIFC	Cat# 11453D
Deposited Data
RNA-Seq data	This paper	GSE113393
ATAC-Seq data	This paper	GSE113412
ScRNA-Seq data	This paper	GSE110692
VAT Treg microarray data	Cipolletta et al., 2015	GSE37535
CD44hi activated Treg microarray data	Levine et al., 2014	GSE61077
Experimental Models: Cell Lines
Platinum-E Retroviral Packaging Cell Line	CELL BIOLABS	RV-101
VAT Treg clone, 53	This paper	N/A
Experimental Models: Organisms/Strains
Mouse: vTreg53 TCR Tg / B6	This paper	N/A
Mouse: Pparg-Tdt / B6	This paper	N/A
Mouse: CD45.1+ / B6	Jackson Laboratory	002014
Mouse: CD45.2+ / B6	Jackson Laboratory	000664
Mouse: RAG1−/− / B6	Jackson Laboratory	002216
Mouse: Foxp3-GFP backcrossed to B6	Bettelli et al., 2006	N/A
Mouse: Foxp3-Cre backcrossed to B6	Rubtsov et al., 2008	N/A
Mouse: Il1rl1flox backcrossed to B6	Chen et al., 2015	N/A
Oligonucleotides
sgRNA targeting Pparg locus protospacer sequence: 5′ GGAACACGTTGTCAGCGGGT	This paper	N/A
Cas9 mRNA	TriLInk Biotechnologies	L-6125
See Table S1 for PCR primers	This paper	N/A
Recombinant DNA
Plasmid: pTαcass- vTreg53α	This paper	N/A
Plasmid: pTβcass- vTreg53β	This paper	N/A
Plasmid: MSCV-IRES-Thy1.1	Wu et al., 2006	Addgene: 17442
Plasmid: MSCV-Foxp3-IRES-Thy1.1	Wu et al., 2006	Addgene: 17443
Plasmid: MSCV-Pparg-Thy1.1	This paper	N/A
Plasmid: MSCV-Il1rl1-Thy1.1	This paper	N/A
Pparg5ARM-IRES-Tdt-3ARM	This paper	N/A
Software and Algorithms
Cuffquant version 2.2.1	Trapnell et al., 2012;	http://cole-trapnell-lab.github.io/cufflinks/install/
GenePattern software package	Broad Institute	http://software.broadinstitute.org/cancer/software/genepattern/
sickle	UC Davis	https://github.com/ucdavis-bioinformatics/sickle
Picard v1.130	Broad Institute	https://github.com/broadinstitute/picard
tophat2	Johns Hopkins University	https://github.com/infphilo/tophat
Bowtie v2.2.4	Langmead and Salzberg, 2012	http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
HOMER (v4.6)	Heinz et al., 2010	http://homer.ucsd.edu/homer/
Bedtools	Quinlan and Hall, 2010	http://bedtools.readthedocs.io/en/latest/index.html
t- SNE	van der Maaten and Hinton, 2008	https://lvdmaaten.github.io/tsne/
R v3.2.1	The R Foundation	https://www.r-project.org
PRISM	GraphPad	https://www.graphpad.com
FlowJo software	FlowJo, LLC	https://www.flowjo.com
Other
Picolab Mouse Diet 20 (no. 5058)	LabDiet	Cat# 0007689
Hydrogel beads	Zilionis et al., 2017	N/A