Antibodies |
anti-CD45.1 (clone A20) |
Biolegend |
Cat# 110724 |
anti-CD45.2 (clone 104) |
Biolegend |
Cat# 109824 |
anti-CD3 (clone 17A2) |
Biolegend |
Cat# 100214 |
anti-CD4 (clone GK1.5) |
Biolegend |
Cat# 100422 |
anti-CD8 (clone 53-6.7) |
Biolegend |
Cat# 100730 |
anti-CD25 (clone PC61) |
Biolegend |
Cat# 102026 |
anti-KLRG1 (clone 2F1/KLRG1) |
Biolegend |
Cat# 138416 |
anti-CD69 (clone H1.2F3) |
Biolegend |
Cat# 104539 |
anti-CXCR3 (clone CXCR3-173) |
Biolegend |
Cat# 126512 |
anti-TCR Vα2 (clone B20.1) |
Biolegend |
Cat# 127806 |
anti-CD45 (clone 30-F11) |
Biolegend |
Cat# 103126 |
anti-CD11b (clone M1/70) |
Biolegend |
Cat# 101230 |
anti-CD11c (clone N418) |
Biolegend |
Cat# 117310 |
anti-F4/80 (clone BM8) |
Biolegend |
Cat# 123114 |
anti-ARTC2 (Treg-Protector, clone S+16a) |
Biolegend |
Cat# 149802 |
anti- IFN-γ (clone XMG1.2) |
Biolegend |
Cat# 505826 |
anti-ST2 (clone RMST2-2) |
eBioscience |
Cat# 46-9335-80 |
anti-Foxp3 (clone FJK-16s) |
eBioscience |
Cat# 17-5773-82 |
anti-Gata3 (clone TWAJ) |
eBioscience |
Cat# 12-9966-42 |
anti-TCR Vβ4 (clone KT4) |
BD Biosciences |
Cat# 553366 |
anti-Thy1.1 (clone OX-7) |
BD Biosciences |
Cat# 561409 |
anti-Thy1.2 (clone 53-2.1) |
BD Biosciences |
Cat#561641 |
anti-ki67 (clone B56) |
BD Biosciences |
Cat#561277 |
anti-Siglec-F (clone E50-2440) |
BD Biosciences |
Cat# 562068 |
anti-mouse MHC Class II (clone M5/114) |
BioXCell |
Cat# BE0108 |
rat IgG2b isotype control (clone LTF-2) |
BioXCell |
Cat# BE0090 |
anti-IL-33 |
R&D Systems |
Cat# AF3626 |
Goat IgG |
R&D Systems |
Cat# AB-108-C |
Donkey anti-goat Cy3 |
Jackson Immunoresearch |
Cat# 705-165-147 |
Bacterial and Virus Strains |
Biological Samples |
|
|
Chemicals, Peptides, and Recombinant Proteins |
Recombinant murine IL-2 |
Peprotech |
Cat# 212-12 |
Carrier-free recombinant mouse IL-33 |
Biolegend |
Cat# 580506 |
BrdU |
Sigma |
Cat# B5002 |
D-Glucose |
Thermo Fisher SCIENTICIFC |
Cat# D16-500 |
Insulin |
Eli Lilly |
Humulin R U-100 |
Collagenase type II |
Sigma |
Cat# C6885 |
Collagenase type IV |
Gibco |
Cat#17104019 |
DNase I |
Sigma |
Cat# DN25 |
2-Mercaptoethanol |
Sigma |
Cat# M7522 |
Critical Commercial Assays |
Foxp3 / Transcription Factor Staining Buffer Set |
eBioscience |
Cat# 00-5523-00 |
True-Nuclear Transcription Factor buffer set |
Biolegend |
Cat# 424401 |
APC BrdU Flow Kit |
BD Biosciences |
Cat# 552598 |
gBlocks Gene Fragment Customize Synthesis |
Integrated DNA Technologies |
N/A |
Treg-Protector |
Biolegend |
Cat# 149802 |
Percoll |
GE Healthcare |
Cat# 17089109 |
Buffer TCL |
Qiagen |
Cat# 1031576 |
OptiPrep Density Gradient Medium |
Sigma |
Cat# D1556 |
Ultra Sensitive Mouse Insulin ELISA Kit |
Crystal Chem |
Cat# 90080 |
Nextera DNA Sample Prep Kit |
Illumina |
Cat# FC-121-1030 |
HiScribe T7 High Yield RNA Synthesis Kit |
NEB |
Cat# E2040S |
SuperScript™ III Reverse Transcriptase |
Invitrogen |
Cat# 18080093 |
Magnesium RNA fragmentation kit |
Ambion |
Cat# AM8740 |
PrimeScript Reverse Transcriptase |
Takara Clontech |
Cat# 2680B |
RNAClean XP beads |
Beckman Coulter |
Cat# A63987 |
Kapa 2× HiFi HotStart PCR mix |
Kapa Biosystems |
Cat# KK2601 |
TransIT®-293 Transfection Reagent |
Mirus |
Cat# MIR 2705 |
RNeasy Lipid Tissue Mini Kit |
Qiagen |
Cat# 74804 |
Dynabeads™ Untouched™ Mouse CD4 Cells Kit |
Thermo Fisher SCIENTICIFC |
Cat# 11415D |
Dynabeads™ Mouse T-Activator CD3/CD28 for T-Cell Expansion and Activation |
Thermo Fisher SCIENTICIFC |
Cat# 11453D |
Deposited Data |
RNA-Seq data |
This paper |
GSE113393 |
ATAC-Seq data |
This paper |
GSE113412 |
ScRNA-Seq data |
This paper |
GSE110692 |
VAT Treg microarray data |
Cipolletta et al., 2015 |
GSE37535 |
CD44hi activated Treg microarray data |
Levine et al., 2014 |
GSE61077 |
Experimental Models: Cell Lines |
Platinum-E Retroviral Packaging Cell Line |
CELL BIOLABS |
RV-101 |
VAT Treg clone, 53 |
This paper |
N/A |
Experimental Models: Organisms/Strains |
Mouse: vTreg53 TCR Tg / B6 |
This paper |
N/A |
Mouse: Pparg-Tdt / B6 |
This paper |
N/A |
Mouse: CD45.1+ / B6 |
Jackson Laboratory |
002014 |
Mouse: CD45.2+ / B6 |
Jackson Laboratory |
000664 |
Mouse: RAG1−/− / B6 |
Jackson Laboratory |
002216 |
Mouse: Foxp3-GFP backcrossed to B6 |
Bettelli et al., 2006 |
N/A |
Mouse: Foxp3-Cre backcrossed to B6 |
Rubtsov et al., 2008 |
N/A |
Mouse: Il1rl1flox backcrossed to B6 |
Chen et al., 2015 |
N/A |
Oligonucleotides |
sgRNA targeting Pparg locus protospacer sequence: 5′ GGAACACGTTGTCAGCGGGT |
This paper |
N/A |
Cas9 mRNA |
TriLInk Biotechnologies |
L-6125 |
See Table S1 for PCR primers |
This paper |
N/A |
Recombinant DNA |
Plasmid: pTαcass- vTreg53α |
This paper |
N/A |
Plasmid: pTβcass- vTreg53β |
This paper |
N/A |
Plasmid: MSCV-IRES-Thy1.1 |
Wu et al., 2006 |
Addgene: 17442 |
Plasmid: MSCV-Foxp3-IRES-Thy1.1 |
Wu et al., 2006 |
Addgene: 17443 |
Plasmid: MSCV-Pparg-Thy1.1 |
This paper |
N/A |
Plasmid: MSCV-Il1rl1-Thy1.1 |
This paper |
N/A |
Pparg5ARM-IRES-Tdt-3ARM |
This paper |
N/A |
Software and Algorithms |
Cuffquant version 2.2.1 |
Trapnell et al., 2012; |
http://cole-trapnell-lab.github.io/cufflinks/install/ |
GenePattern software package |
Broad Institute |
http://software.broadinstitute.org/cancer/software/genepattern/ |
sickle |
UC Davis |
https://github.com/ucdavis-bioinformatics/sickle |
Picard v1.130 |
Broad Institute |
https://github.com/broadinstitute/picard |
tophat2 |
Johns Hopkins University |
https://github.com/infphilo/tophat |
Bowtie v2.2.4 |
Langmead and Salzberg, 2012 |
http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
HOMER (v4.6) |
Heinz et al., 2010 |
http://homer.ucsd.edu/homer/ |
Bedtools |
Quinlan and Hall, 2010 |
http://bedtools.readthedocs.io/en/latest/index.html |
t- SNE |
van der Maaten and Hinton, 2008 |
https://lvdmaaten.github.io/tsne/ |
R v3.2.1 |
The R Foundation |
https://www.r-project.org |
PRISM |
GraphPad |
https://www.graphpad.com |
FlowJo software |
FlowJo, LLC |
https://www.flowjo.com |
Other |
Picolab Mouse Diet 20 (no. 5058) |
LabDiet |
Cat# 0007689 |
Hydrogel beads |
Zilionis et al., 2017 |
N/A |