Table 8.
Sequences of the primers and probes for the target genes of the three oral bacteria contained in the OB mRT-PCR kit.
| Oral bacteria | Primer/ Probe | Sequence (5′-3′) | Length (bp) | Tm (°C) | Expected size (bp) |
|---|---|---|---|---|---|
| S. salivarius | Forward | tgaacaagcrgtwgtcggtaac | 22 | 56.3 | 108 |
| Reverse | actccgtgtccaaccaaatc | 20 | 55.2 | ||
| Probe | FAM-agtcgtggttacggtgttgttcgt-BHQ1 | 24 | 60.6 | ||
| S. sanguinis | Forward | ggttaatgccgataatgcgatg | 22 | 54.4 | 108 |
| Reverse | cggctcatatcgtaaattccaatg | 24 | 54.1 | ||
| Probe | HEX-tgccttgggctatttagtcagcct-BHQ1 | 24 | 60.4 | ||
| N. subflava | Forward | ccaacgatgttgccgaattg | 20 | 55.0 | 79 |
| Reverse | tggaagacggatttggtgtaat | 22 | 54.2 | ||
| Probe | TexasRed-ttatcgttacctgtcagggtggcg-BHQ1 | 24 | 60.6 |