Table 1. Transcription factors and their binding sites.
| TF family | No. of TF in abiotic | No. of TF in biotic | TFBS |
|---|---|---|---|
| ARF | 1 | 3 | TGTCTC auxin response elements (AuxRE) |
| BBR-BPC | 1 | – | (GA/TC)8 and GAGA-binding |
| bHLH | 3 | 9 | E-box (5′-CANNTG-3′) |
| C2H2 | – | 9 | A DNA element that contains an AGCT core |
| C3H | – | 1 | Unknown |
| ERF | 5 | 18 | GCC box is an 11 bp sequence (TAAGAGCCGCC) |
| EIL | 3 | 2 | EIL2 BS in ERF1 (TTCAAGGGGGCATGTATCTTGAA) |
| FAR1 | – | 1 | FBS for FHY3-FAR1 binding site |
| GATA | – | 1 | WGATAR (W = T or A; R = G or A) motifs |
| GRAS | 1 | 7 | cis-element AATTT |
| HSF | – | 3 | This consists of a tandem of inverted repeats of the sequence GAA, generating a perfect HSE, TTCnnGAAnnTTC |
| LBD | – | 1 | Core sequence CGGC |
| MIKC_MADS | – | 1 | Keratin-like coiled-coil domain |
| MYB and MYB_related | 2 | 8 | (CNGTTR), (GKTWGTTR), TAACPy sequence (only one AAC sequence) and (GKTWGGTR; R, A or G; K, G or T; W, A or T) and EE, AGATATTT |
| NAC | 5 | 4 | NAC recognition site (NACRS), NAC binding element (SNBE) with a longer and variable sequence ([T/A]NN[C/T][T/C/G]TNNNNNNNA[A/C]GN[A/C/T][A/T]) |
| NF-YB | – | 3 | CCAAT binding |
| NF-YC | 1 | – | Core nucleotide sequence CCAAT |
| PHD | – | 1 | Unknown |
| SPL proteins | – | 1 | SBP-box, TNCGTACAA |
| TALE | 2 | 1 | Pbx:Meinox binding site (CTGTCAATCA) |
| TCP | – | 2 | GGNCCCAC sequences and s G(T/C)GGNCCC |
| TIFY | – | 1 | Unknown |
| VOZ | 1 | – | GCGTNx7ACGC |
| WRKY | 3 | 9 | W box (TTGACY; Y, C or T) |
| YABBY | – | 1 | WATNATW (W = T or A; R = G or A) |
| ZIP and HD-ZIP | 3 | 6 | Motif AATNATT |
Notes:
Transcription factor and binding site for each, in biotic and abiotic stresses. TF, Transcription factor; TFBS, Transcription factor binding site.