Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Recombinant DNA reagent (Drosophila melanogaster) |
Egalitarian (Egl) cDNA | Epoch Life Sciences | Corresponding to NCBI:NM_166623 |
Codon optimised for Sf9 cell expression |
| Recombinant DNA reagent (D. melanogaster) |
Bicaudal-D (BicD) cDNA | Epoch Life Sciences | Corresponding to NCBI:NM_165220 |
Codon optimised for Sf9 cell expression |
| Recombinant DNA reagent (Mus musculus) |
Bicaudal-D2 (BICD2) cDNA | Epoch Life Sciences | Corresponding to NCBI:NM_001039179 |
Codon optimised for Sf9 cell expression |
| Recombinant DNA reagent (Homo sapiens) |
Dynein heavy chain (DHC) cDNA |
Epoch Life Sciences; PMID:24986880 |
Corresponding to NCBI:NM_001376.4 |
Codon optimised for Sf9 cell expression |
| Recombinant DNA reagent (H. sapiens) |
Dynein intermediate chain 2 (DIC2) cDNA |
Epoch Life Sciences; PMID:24986880 |
Corresponding to NCBI:AF134477 |
Codon optimised for Sf9 cell expression |
| Recombinant DNA reagent (H. sapiens) |
Dynein light intermediate chain 2 (DLIC2) cDNA |
Epoch Life Sciences; PMID:24986880 |
Corresponding to NCBI:NM_006141.2 |
Codon optimised for Sf9 cell expression |
| Recombinant DNA reagent (H. sapiens) |
Dynein light chain Tctex (Tctex) cDNA |
Epoch Life Sciences; PMID:24986880 |
Corresponding to NCBI:NM_006519.2 |
Codon optimised for Sf9 cell expression |
| Recombinant DNA reagent (H. sapiens) |
Dynein light chain LC8 (LC8) cDNA |
Epoch Life Sciences; PMID:24986880 |
Corresponding to NCBI:NM_003746.2 |
Codon optimised for Sf9 cell expression |
| Recombinant DNA reagent (H. sapiens) |
Dynein light chain Roadblock (Robl) cDNA |
Epoch Life Sciences; PMID:24986880 |
Corresponding to NCBI:NM_141183.3 |
Codon optimised for Sf9 cell expression |
| Recombinant DNA reagent |
pAceBac1 plasmid | PMID:27165327 | ||
| Recombinant DNA reagent | pIDC plasmid | PMID:27165327 | ||
| Recombinant DNA reagent (D. melanogaster) |
hairy 3’UTR plasmid | PMID:12743042 | ||
| Recombinant DNA reagent (D. melanogaster) |
I-factor plasmid | PMID:15992540 | ||
| Sequence-based reagent |
ILS RNA 5’.AAUGCACACCUCCCUCGUCACU CUUGAUUUUUCAAGAGCCUUCG AUCGAGUAGGUGUGCA.3’ |
GE Dharmacon | With or without 5’ Dy647 label |
|
| Sequence-based reagent |
ILS scram RNA 5’.AAAAUGUGGUGCACUAUCUU CGUAUUCCAGUGCCACCGUGG UCUAAUUCACUCGUCGCC.3’ |
GE Dharmacon | With or without 5’ Dy547 label |
|
| Cell line (Spodoptera frugiperda) |
Sf9 | ThermoFisher Scientific | ThermoFisher Scientific: 11496015 |
Mycoplasma-free |
| Genetic reagent (D. melanogaster) |
P[tub-Egl::GFP] | PMID:19515976 | FLYB:FBal0230300 | |
| Genetic reagent (D. melanogaster) |
Sco/CyO P[actin5C-GFP] | Bloomington Drosophila
Stock Center |
FLYB: FBst0004533; RRID:BDSC_4533 |
|
| Antibody | anti-GFP (mouse monoclonal) | Sigma Aldrich | Sigma-Aldrich:11814460001; RRID:AB_390913 |
Mix of clones 7.1 and 13.1 (1:1000) |
| Antibody | anti-D. melanogaster Dhc (mouse monoclonal) |
Developmental Studies Hybridoma Bank; PMID:10637305 |
DSHB:2C11-2; RRID:AB_2091523 |
(1:1000) |
| Antibody | anti-D. melanogaster p150-C- term (rabbit polyclonal) |
PMID:17325206 | Raised against aa 1,073–1,280 (1:10,000) |
|
| Commercial assay, kit | GFP-trap magnetic agarose beads |
Chromotek | Chromotek:gtma-20 | |
| Commercial assay, kit | Coomassie protein assay kit | ThermoFisher Scientific | ThermoFisher Scientific: 23200 |
|
| Commercial assay, kit | Full-Range Rainbow prestained molecular weight markers |
GE Healthcare | GE Healthcare:RPN800E | |
| Commercial assay, kit | Coomassie Instant Blue protein stain |
Expedeon | Expedeon:ISB1L | |
| Commercial assay, kit | MEGAScript T7 transcription kit |
ThermoFisher Scientific | ThermoFisher Scientific: AM1333 |
|
| Commercial assay, kit | MEGAScript SP6 transcription kit |
ThermoFisher Scientific | ThermoFisher Scientific: AM1330 |
|
| Chemical compound, drug |
Alexa488-UTP | ThermoFisher Scientific | ThermoFisherScientific: C11403 |
|
| Chemical compound, drug |
Cy3-UTP | PerkinElmer | PerkinElmer:NEL582001EA | |
| Chemical compound, drug |
Cy5-UTP | PerkinElmer | PerkinElmer: NEL583001EA | |
| Chemical compound, drug |
SNAP-Cell TMR-Star | New England Biolabs | NEB:S9105S | |
| Chemical compound, drug |
SNAP-Surface Alexa Fluor 647 |
New England Biolabs | NEB:S9136S | |
| Chemical compound, drug |
PEG | Rapp Polymere | Rapp Polymere:103000–20 | |
| Chemical compound, drug |
Biotin-PEG | Rapp Polymere | Rapp Polymere: 133000-25-20 | |
| Chemical compound, drug |
PLL-g-PEG | Susos AG | Susos AG:PLL(20)-g[3.5]- PEG(2) |
|
| Chemical compound, drug |
Pluronic-F127 | Sigma-Aldrich | Sigma-Aldrich:P2243 | |
| Chemical compound, drug |
Paclitaxel (taxol) | Sigma-Aldrich | Sigma-Aldrich:T1912 | |
| Chemical compound, drug |
GMPCPP | Jena Bioscience | Jena Bioscience:NU-405 | |
| Other, native protein | Glucose oxidase | Sigma-Aldrich | Sigma-Aldrich:G2133 | |
| Other, native protein | Catalase | Sigma-Aldrich | Sigma-Aldrich:C40 | |
| Other, native protein | Streptavidin | Sigma-Aldrich | Sigma-Aldrich:S4762 | |
| Other, native protein | α-casein | Sigma-Aldrich | Sigma-Aldrich:C6780 | |
| Other, native protein | Porcine tubulin, unlabelled | Cytoskeleton Inc. | Cytoskeleton Inc:T240 | |
| Other, native protein | Porcine tubulin, biotin-conjugated |
Cytoskeleton Inc. | Cytoskeleton Inc:T333P | |
| Other, native protein | Porcine tubulin, HiLyte 488-conjugated |
Cytoskeleton Inc. | Cytoskeleton Inc:TL488M | |
| Software, algorithm | FIJI | PMID:22743772 | RRID:SCR_002285 | |
| Software, algorithm | Prism | Graphpad | RRID:SCR_002798 | |
| Software, algorithm | Sednterp | T. Laue (University of New Hampshire) |
RRID:SCR_016253 | |
| Software, algorithm | SEDPHAT 13b | PMID:12895474 | RRID:SCR_016254 | |
| Software, algorithm | GUSSI | PMID:26412649 | RRID:SCR_014962 | |
| Software, algorithm | ASTRA | Wyatt | RRID:SCR_016255 |