Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
sgRNAs Used to Target DGAT1 for CRISPR/Cas9 Gene Editing
| sgRNA ID | Core sequence DNA | Position DGAT1 gene | Predicted cleavagea |
|---|---|---|---|
| sgRNA#2 | GGCACCATGAGTTGACGTCG | Exon 7 | 13621-13622 (AC) |
| sgRNA#6 | TGTGCGCCATCAGCGCCAGC | Exon 7 | 13570-13571 (TG) |
| sgRNA#7 | GTGCGCCATCAGCGCCAGCA | Exon 7 | 13569-13570 (CT) |
| sgRNA#8 | GTGGCTGGCCCGAGACAGAT | Intron 6–7 | 13486-13487 (CT) |
sgRNA, single-guide RNA.
According NCBI Reference Sequence: NG_034192.1; Homo sapiens diacylglycerol O-acyltransferase 1 (DGAT1).
