Skip to main content
NCBI home page
Cerebral Cortex (New York, NY) logoLink to Cerebral Cortex (New York, NY)
. 2016 Jun 23;27(7):3600–3608. doi: 10.1093/cercor/bhw181

Dopamine is Required for Activity-Dependent Amplification of Arc mRNA in Developing Postnatal Frontal Cortex

Yizhou Ye 1, Surjeet Mastwal 1, Vania Yu Cao 1, Ming Ren 1, Qing Liu 1, Wenyu Zhang 1, Abdel G Elkahloun 2, Kuan Hong Wang 1,*
PMCID: PMC6059174  PMID: 27365296

Abstract

The activity-regulated gene Arc/Arg3.1 encodes a postsynaptic protein crucially involved in glutamatergic synaptic plasticity. Genetic mutations in Arc pathway and altered Arc expression in human frontal cortex have been associated with schizophrenia. Although Arc expression has been reported to vary with age, what mechanisms regulate Arc mRNA levels in frontal cortex during postnatal development remains unclear. Using quantitative mRNA analysis of mouse frontal cortical tissues, we mapped the developmental profiles of Arc expression and found that its mRNA levels are sharply amplified near the end of the second postnatal week, when mouse pups open their eyes for the first time after birth. Surprisingly, electrical stimulation of the frontal cortex before eye-opening is not sufficient to drive the amplification of Arc mRNA. Instead, this amplification needs both electrical stimulation and dopamine D1-type receptor (D1R) activation. Furthermore, visual stimuli-driven amplification of Arc mRNA is also dependent on D1R activation and dopamine neurons located in the ventral midbrain. These results indicate that dopamine is required to drive activity-dependent amplification of Arc mRNA in the developing postnatal frontal cortex and suggest that joint electrical and dopaminergic activation is essential to establish the normal expression pattern of a schizophrenia-associated gene during frontal cortical development.

Keywords: activity-dependent gene expression, arc, dopamine, frontal cortex, postnatal development

Introduction

The mammalian frontal cortex undergoes extensive postnatal development (Rosenberg and Lewis 1995; Huttenlocher and Dabholkar 1997; Sur and Rubenstein 2005), and aberrant frontal cortical maturation is implicated in neurodevelopmental psychiatric disorders such as schizophrenia (Lewis and Levitt 2002; Rapoport et al. 2012). Recent large-scale human genetic studies of schizophrenia have shown that rare disruptive mutations, de novo copy number variants, and de novo deleterious single-nucleotide variants are all enriched in a subset of postsynaptic density proteins (such as DLG1, CYFIP1, BAIAP2, and IQSEC2) that biochemically interact with the activity-regulated cytoskeleton-associated protein Arc/Arg3.1 (Kirov et al. 2012; Fromer et al. 2014; Purcell et al. 2014). In addition, a chromosomal microdeletion encompassing the Arc gene and a single-nucleotide polymorphism within the Arc gene have been reported to associate with neurodevelopmental psychiatric disorders and schizophrenia (Hu et al. 2015; Huentelman et al. 2015). Reduced expression of Arc mRNA has also been detected in the frontal cortex of schizophrenia subjects (Guillozet-Bongaarts et al. 2014). Although previous animal studies have demonstrated a crucial role of Arc in regulating postsynaptic glutamate receptors and neuronal plasticity in the frontal cortex (Shepherd and Bear 2011; Ren et al. 2014; Cao et al. 2015), little is known about the regulation of Arc mRNA levels during postnatal development of the frontal cortex.

Arc was initially identified in adult brain based on its rapid and strong induction in response to electrical seizure activity (Link et al. 1995; Lyford et al. 1995). Subsequent studies have shown that exposure to a novel environment or behavioral training can induce Arc expression in input-specific neuronal ensembles in the adult brain (Guzowski et al. 1999; Wang et al. 2006; Shepherd and Bear 2011). In neuronal cultures, electrical activation of neurons appears to be sufficient to amplify the expression of Arc mRNA, via a signaling cascade triggered by calcium influx from voltage-gated calcium channels or N-methyl-D-aspartate receptors (Shepherd et al. 2006; Bloomer et al. 2008; Lyons and West 2011). In the neonatal rodent brain, by contrast, despite the occurrence of spontaneous neural activity and calcium waves (Khazipov and Luhmann 2006; Ackman et al. 2012), previous studies detected little expression of Arc mRNA (Lyford et al. 1995; Sanders et al. 2008). It remains to be determined whether increasing neural activity levels in the neonatal brain would be sufficient to drive the amplification of Arc mRNA. Alternatively, other regulatory mechanisms may play essential roles in the amplification of Arc expression during postnatal cortical development.

Besides electrical activity, Arc expression in adult brain is influenced by a variety of neuromodulators in a brain region– specific manner (Fosnaugh et al. 1995; Pei et al. 2000; Sanders et al. 2008; Gil-Bea et al. 2011; Soule et al. 2012; de Bartolomeis et al. 2015). The frontal cortex receives prominent dopaminergic innervation (Verney et al. 1982; Kalsbeek et al. 1988) and activation of dopaminergic signaling through D1-type receptors (D1R), but not D2-type receptors (D2R), can enhance Arc transcription in adult brain (Fosnaugh et al. 1995). However, since dopaminergic signaling is not required for Arc expression induced by electrical activation in neuronal cultures, dopamine is generally thought to augment rather than to induce Arc expression (Shepherd et al. 2006; Bloomer et al. 2008). In addition, dopaminergic innervation of the frontal cortex exhibits a protracted postnatal development, reaching a high innervation density by adulthood (Verney et al. 1982; Kalsbeek et al. 1988; Mastwal et al. 2014). During early postnatal development of the frontal cortex, it is not known whether dopaminergic signaling may play any role in the amplification of Arc mRNA expression.

To investigate the regulation of Arc mRNA expression during early postnatal development of the frontal cortex, we used quantitative RNA analysis to map the developmental profiles of Arc mRNA levels in mice housed in their regular home cages. We found sharp amplification of Arc mRNA levels near the end of the second postnatal week, when mouse pups open their eyes for the first time after birth. As we expected, our findings showed that natural visual stimuli drive the amplification of Arc mRNA in the early postnatal frontal cortex. Surprisingly, however, electrical neural stimulation alone is not sufficient to drive the amplification of Arc mRNA in the frontal cortex before eye-opening. Instead, this amplification requires both electrical stimulation and D1R activation. Furthermore, natural visual stimuli-driven amplification of Arc mRNA, as well as the mRNAs of multiple other immediate early genes (IEGs), depends on D1R activation. Finally, we found that dopamine neurons located in the ventral midbrain are needed for the amplification of Arc mRNA during early frontal cortical development. These results reveal that dopamine is required to drive activity-dependent amplification of Arc mRNA in early postnatal development of the frontal cortex and suggest that combined electrical and dopaminergic activation is essential to establish the normal expression pattern of a schizophrenia-associated gene during frontal cortical development.

Materials and Methods

Animals

Wild-type mice in C57BL/6 strain were group-housed (2–4 animals per cage) in a temperature- and humidity- controlled animal facility, maintained on a 12-h light:dark cycle, and fed ad libitum. Birth was defined as postnatal day zero (P0). Experimental procedures were approved by the NIMH Animal Care and Use Committee.

Quantitative Real-Time Polymerase Chain Reaction

Frontal cortical tissue samples were dissected from mice either from the home cage or 0.5 h after treatment. Samples were then homogenized in TRIzol with a Polytron homogenizer. The homogenate was stored for 5 min at room temperature to allow for the complete dissociation of nucleoprotein complexes. Total RNA was then isolated using the RNeasy kit (Qiagen). To analyze mRNA expression level, cDNA was produced using reverse transcriptase (Life technologies) with random hexamer primers and then measured with quantitative reverse-transcription polymerase chain reaction (qRT-PCR) using TaqMan probes in the 7900HT Real-time PCR system (Applied Biosystems). Pre-made Taqman assays (Arc, Mm00479619_g1; GAPDH, Mm99999915_g1) and custom-designed primers and taqman probes (Actin, 5′ ACCCCATTGAACATGGCATT 3′, 5′ TGTAGAAGGTGTGGTGCCAGAT 3′, 6FAM TTACCAACTGGGACGACATGGAGAA; PrimerExpress, Applied Biosystems) were used. The Arc mRNA expression level was determined by the Arc cDNA concentration normalized to the Actin or GAPDH cDNA concentration.

Eye-Opening Paradigm

P12 mice with closed eyelids were kept in their home cage in the dark overnight. On the next day, P13 mice, which were confirmed by human observers wearing infrared goggles to have opened their eyelids in dark, were separated into different groups: one group received SCH23390 injection (0.2 mg/kg, intraperitoneally), one group received saline injection and the other, without injection. The groups were again split, with half of the each group being exposed to light for 2 h, and the other half remaining in the dark for the same period of time.

Electroconvulsive Stimulation

Mice were gently restrained by scruffing. After wetting the skin around the ear with saline, electrical conductive gel was applied, and an electrical stimulus (2 s, 100 Hz, 10 mA) was delivered across skull. The animal was visually monitored until recovery from muscle contraction, normally within 5 min. After this recovery period, the animal was placed back in its home cage. For combined amphetamine and ES treatment, mouse received ES 15 min after amphetamine administration (5 mg/kg, intraperitoneally).

Drugs

Amphetamine sulphate, 5 mg/kg and SCH23390 hydrochloride, 0.2 mg/kg, were dissolved in saline and administered intraperitoneally.

Immunohistochemistry

Mouse brains were fixed in 4% paraformaldehyde, and imbedded in 1.5–3% agarose. Of note, 50 μm brain sections were cut with vibratome. Those sections were permeabilized by 0.3% Triton X-100 in phosphate buffered saline (PBST) for 20 min and blocked with 10% goat serum in the PBST for 1 h. The sections were then incubated in antibodies against tyrosine hydroxylase (TH) (1:10 000, Millipore) overnight at 4 °C. After washing with PBS for 30 min at room temperature, sections were incubated for 2 h with Alexa 488 goat anti-rabbit IgG (1:100, Santa Cruz) at room temperature. Brain sections were imaged with confocal microscopy (FV1000; Olympus). Frontal cortex images were analyzed using ImageJ blindly with regard to experimental conditions. After applying line filters based on Hessian matrix (FeatureJ plugin) with a smoothing scale of 2 pixels, the images were thresholded at 3 standard deviations above background. Line-like structures that were larger than 30 pixels and had a circularity index less than 0.5 were automatically selected. The total number of selected pixels in each image was calculated to indicate the extent of TH staining.

Animal Surgery and Lesion of Ventral Tegmental Area Dopamine Neurons

P9 mice were anesthetized with isoflurane and injected with 1 μL saline with or without 5 μg 6-OHDA and 0.2 μg ascorbic acid in the right ventral tegmental area (VTA). The skin over the skull was incised to expose Bregma. A small hole was then drilled at stereotaxic coordinates: P3.8, L0.5 and V3.5. The injection was made with a 5 μL Hamilton syringe over a 10-min period. After the injection was completed, the needle was left in place for another 10 min to reduce backup of the solution into the track of the injection needle, and then withdrawn. The skin over the skull was brought together and sutured, and the mouse was returned to its home cage. Ketoprofen fluid (100 mg/mL in 0.9% saline; 5 mg/kg body weight) was administered for the following 2 days.

Gene Expression Microarray

Gene expression analysis was conducted by the NIMH Microarray Core facility. Samples were prepared according to Affymetrix protocols (Affymetrix, Inc.). RNA quality was ensured using the Bioanalyzer (Agilent Inc.), and quantity was measured using NanoDrop. Per RNA labeling, 200 ng of total RNA was used in the Affymetrix recommended protocol for Affymetrix GeneChip mouse gene standard 2.0 arrays (Affymetrix, Inc.). Resulting data were analyzed using Partek Genomic Suite software (version 6.6; Partek Genomic).

Statistical Analysis

Statistical differences between two groups were determined with two-sided Student's t-test. Statistical differences among three groups or more were determined using one-way or two-way analysis of variance (ANOVA), followed by multiple comparison tests. Data are displayed as mean ± SEM.

Results

Arc mRNA Expression Level is Amplified During Early Postnatal Development of the Frontal Cortex

To study the regulation of Arc mRNA expression during postnatal development of the mouse frontal cortex, we first focused on the developmental profile of Arc expression. Using real-time qRT-PCR analysis, we investigated the steady state level of Arc mRNA expression in the frontal cortex of mice housed in their regular home cages during the light phase. We found that Arc mRNA expression starts at a very low level on postnatal day 7 (P7) but amplifies sharply from P11 to P13, and remained at a high level in adulthood (P60) (Fig. 1A; one-way ANOVA, F(7, 32) = 33.40, P < 0.0001, n = 3–6 mice per age group; post-test, P11 vs. P13, P < 0.0001). The same developmental profile was observed when Arc mRNA expression level was normalized against housekeeping gene Actin or GAPDH (supplementary fig. S1). These results suggest that Arc mRNA expression level is amplified during early postnatal development of the frontal cortex.

Figure 1.

Figure 1.

Open in a new tab

Arc mRNA expression level in the mouse frontal cortex is amplified after eye-opening in early postnatal development. (A) qRT-PCR analysis shows that Arc mRNA levels in the mouse frontal cortex amplify sharply from postnatal (P) days 11–13 and remain high at P60 (one-way ANOVA, F(7,32) = 33.40, P < 0.0001, n = 3–6 mice per age group; post-test, P11 vs. P13, ****P < 0.0001). The expression level of Arc is normalized to that of Actin. All error bars indicate standard error of the mean (SEM). (B) Eye-opening paradigm for studying the amplification of Arc mRNA by natural visual stimuli after eye-opening on P13. (C) qRT-PCR analysis of Arc mRNA expression showed a significant increase in P13 mice after 2 h of exposure to light. The age-matched control mice were kept in the dark for the same period of time (t-test, *P = 0.0293, n = 3 per group). All error bars indicate SEM.

Natural Visual Stimuli Drive the Amplification of Arc mRNA in Early Postnatal Frontal Cortex

We noticed that the sharpest amplification of Arc mRNA level occurs between P11 and P13. During this period, mouse pups open their eyes for the first time after birth (Fox 1965). As natural visual inputs will activate visual cortical neurons, which send excitatory glutamatergic innervations to the frontal cortex (Uylings et al. 2003), we reasoned that the arrival of visual inputs with eye-opening might cause a rapid rise in frontal cortical Arc expression. We identified a group of P12 mice with eyelids still closed and kept them in the dark overnight. After verifying that those mice opened their eyelids in the dark on P13, we exposed half of the group to light for 2 h and kept the others in the dark for the same period of time (Fig. 1B). Confirming our prediction, qRT-PCR analysis revealed that the light-exposed mice showed a significant increase in Arc mRNA level (t-test, P = 0.0293, n = 3 mice per group; Fig. 1C). This finding suggests that natural visual stimuli drive the amplification of Arc mRNA in early postnatal frontal cortex.

Electrical Stimulation Is not Sufficient to Drive the Amplification of Arc mRNA in Early Postnatal Frontal Cortex

Given the strong induction of Arc expression by visual stimuli in P13 frontal cortex, we thought that the low level of Arc expression before eye-opening might be attributed to a lack of activating neural stimuli at this age. To determine whether neural stimulation will be sufficient to amplify Arc expression in neonatal mice before eye-opening, a strong stimulation method that does not disrupt the fragile neonatal brain tissue needs to be applied. Although optogenetic methods can powerfully drive synchronous neural activation (Tye and Deisseroth 2012), these methods require invasive brain surgery for virus injection and light delivery, and a long waiting time (~2 weeks) for channelrhodopsin expression. These requirements make the application of optogenetic methods to neonatal brain challenging. However, previous studies have shown that noninvasive synchronous neural activation by electroconvulsive stimulation (ES), which involves a brief high-frequency electrical stimulus applied through head-attached electrodes, robustly induces Arc expression in the adult cortex (Lyford et al. 1995; Ma et al. 2009; Guo et al. 2011). We therefore adopted this method to determine whether electrical stimulation would be sufficient to amplify Arc expression in P9 frontal cortex.

To confirm the effectiveness of ES, we videotaped P9 mice before and during an electroconvulsive stimulus (2 s, 100 Hz, 10 mA). We found that ES in P9 mice reliably evoked limb movements (supplementary fig. S2), indicating that this treatment is effective. However, ES did not significantly affect Arc expression in P9 frontal cortex, even though it robustly induced Arc expression in adult P60 frontal cortex (Fig. 2A; two-way ANOVA, Age-by-ES interaction, F(1,8) = 17.20, P = 0.0032, n = 3 mice per condition; post-tests: P9, No stimulation vs. ES stimulated, P = 0.3187; P60, no stimulation vs. ES stimulated, P = 0.0002). Thus, ES alone is not sufficient to drive the amplification of Arc mRNA in early postnatal frontal cortex.

Figure 2.

Figure 2.

Open in a new tab

Amplification of Arc mRNA in early postnatal frontal cortex requires both electrical activity and D1R activation. (A) ES is not sufficient to drive the amplification of Arc mRNA in P9 frontal cortex, while it robustly increases Arc expression in adult P60 frontal cortex (two-way ANOVA, age-by-treatment interaction, F(1, 8) = 17.20, P = 0.0032, n = 3 mice per condition; post-tests: P9, No stimulation vs. ES stimulated, P = 0.3187; P60, No stimulation vs. ES stimulated, ***P = 0.0002). (B) In P9, joint Amphetamine (Amph) and ES stimulation significantly amplifies Arc mRNA expression (one-way ANOVA, F(3,21) = 14.44, P < 0.0001, n = 6–7 mice per condition; post-tests, Amph vs. Home Cage, P > 0.9999; ES vs. Home Cage, P = 0.1364; Amph/ES vs. Home Cage, ****P < 0.0001). Amph and ES's effects on Arc mRNA expression are synergistic (two-way ANOVA, Amph-by-ES interaction, F(1, 21) = 4.732, P = 0.0412). Injection of D1R-specific antagonist SCH23390, moreover, blocks the synergistic effect of Amph/ES treatment (t-test, **P = 0.0043; Amph/ES with saline: n = 5 mice; Amph/ES with D1R ATN: n = 6 mice), suggesting that D1R signaling is required.

Amplification of Arc mRNA in Early Postnatal Frontal Cortex Requires Both Electrical Stimulation and D1R Activation

Next, we investigated whether neuromodulators may be required to drive the amplification of Arc mRNA in early postnatal frontal cortex. Although ES could affect neuromodulator release in adult frontal cortex (Glue et al. 1990), this treatment alone was apparently not sufficient to amplify Arc mRNA in P9 frontal cortex. However, the psychostimulant amphetamine (Amph) is known to potently release catecholaminergic neuromodulators, including dopamine, while not strongly affecting the population activity of frontal cortical neurons (Sulzer et al. 2005; Wood et al. 2012). We therefore tested whether Amph may affect the induction of Arc mRNA in P9 frontal cortex. Our results showed that although a single dose of Amph (5 mg/kg, intraperitoneally) or single application of ES alone did not produce significant increase in P9 frontal cortex, combined Amph/ES treatment greatly enhanced Arc expression (one-way ANOVA, F(3,21) = 14.44, P < 0.0001, n = 6–7 mice per condition; post-tests, Amph vs. home cage, P > 0.9999; ES vs. Home Cage, P = 0.1364; Amph/ES vs. Home Cage, P < 0.0001; Fig. 2B). We verified that the Amph/ES treatment did not affect the expression of housekeeping genes Actin or GAPDH, which were used for normalizing Arc mRNA levels across subjects (supplementary fig. S3). The effect of Amph and ES administered together is greater than the additive effect of either treatment alone on Arc expression, indicating that the action of Amph and ES is synergistic (two-way ANOVA, Amph-by-ES interaction, F(1,21) = 4.732, P = 0.0412).

A previous study in adult rats suggested that D1R-specific antagonist SCH23390, but not D2R antagonist, might inhibit psychostimulant-induced Arc mRNA expression (Fosnaugh et al. 1995). In addition, D1R is expressed in neonatal frontal cortical neurons (Leslie et al. 1991). To assess the necessity of D1R activation in the amplification of Arc expression in P9 mouse frontal cortex, we administered SCH23390 before combined amphetamine and ES treatment. To avoid mechanical disruption of neurons and Arc expression, which would result from local drug infusion into the P9 frontal cortex, SCH23390 (0.2 mg/kg) or saline was delivered intraperitoneally. We found that the effect of Amph/ES was blocked by SCH23390 (t-test, P = 0.0043, Amph/ES with saline, n = 5 mice, vs. Amph/ES with SCH23390, n = 6 mice; Fig. 2B). This finding suggests that the effect of amphetamine/ES on Arc expression is mediated through D1R, and other neuromodulatory pathways activated by Amph cannot replace the function of D1R signaling in early postnatal frontal cortex.

Natural Visual Stimuli-driven Amplification of Arc mRNA in Early Postnatal Frontal Cortex also Requires D1R Activation

To further assess the necessity of D1R activation in the amplification of Arc expression, we investigated whether D1R antagonist may inhibit the induction of Arc mRNA by natural visual stimuli in the early postnatal frontal cortex. We administered SCH23390 (0.2 mg/kg) or saline by intraperitoneal injection to dark-adapted P13 mice before light stimulation. Each of the two groups were then split again, with half exposed to light for 2 h and the other half kept in the dark for the same period of time (Fig. 3A).

Figure 3.

Figure 3.

Open in a new tab

Natural visual stimuli-driven amplification of Arc mRNA in early postnatal frontal cortex also requires D1R activation. (A) Eye-opening paradigm for studying the amplification of Arc mRNA in P13 frontal cortex by natural visual stimuli and the effects of D1R signaling. (B) Arc mRNA amplifies significantly following exposure to visual stimulation in saline-injected P13 mice only. Injection with the D1R antagonist SCH23390 (D1R ANT) completely blocked visual stimulation-induced Arc expression (one-way ANOVA, F(3, 38) = 34.01, P < 0.0001, n = 10–11 mice per condition; Post-tests: Light/Saline vs. Dark/Saline, ****P < 0.0001; Light/D1R ANT vs. Dark/D1R ANT, P > 0.9999). All error bars indicate SEM.

Quantitative RT-PCR analysis of Arc expression in the frontal cortex showed a significant increase only in control mice (injected with saline) that were exposed to novel visual stimulation. In mice injected with D1R antagonist, by contrast, visual stimulation's ability to induce Arc expression was completely blocked (one-way ANOVA, F(3,38) = 34.01, P < 0.0001, n = 10–11 mice per condition; post-tests, Light/Saline vs. Dark/Saline, P < 0.0001; Light/D1R ANT vs. Dark/D1R ANT, P > 0.9999; Fig. 3B). These results suggest that natural visual stimuli-driven amplification of Arc mRNA in early postnatal frontal cortex also requires D1R activation.

Natural Visual Stimuli Amplify the mRNAs of Multiple IEGs in a D1R-dependent Manner

We next investigated whether dopaminergic signaling is also required for the amplification of the mRNAs of other IEGs in the postnatal mouse frontal cortex. Using microarray analyses of mRNA expression profiles, we systematically identified genes that were induced by novel visual experience in a D1R signaling-dependent manner under the same eye-opening paradigm in P13 mice. Based on the statistical criteria of a genome-wide false discovery rate of less than 0.05 (which corresponds to a stringent individual t-test P value <3 × 10−5), we identified 8 genes whose expression levels after light stimulation were at least 1.5-fold greater than in controls kept in the dark or in mice treated with D1R antagonist (Fig. 4A,B). Remarkably, all these 8 genes (Arc, Fos, FosB, Npas4, NR4a1, Egr2, Junb, Gadd45b) have been previously shown as neural activity-dependent IEGs in adult animals (O'Donovan et al. 1999; French et al. 2001; Lin et al. 2008; Ma et al. 2009; West and Greenberg 2011; Nestler 2014). Our finding that novel visual input induced-expression of these genes in P13 mice depends on D1R signaling suggests that in postnatal frontal cortex, dopaminergic signaling is generally required for the activity-dependent amplification of gene expression.

Figure 4.

Figure 4.

Open in a new tab

Natural visual stimuli amplify the expression of multiple IEGs in a D1R-dependent manner. (A) Volcano plot of P value against estimated fold-of-change for all the genes in the mouse expression microarray. Eight genes (circled, top right region) were selected based on statistical criteria for genome-wide FDRs <0.05 and a fold of change >1.5. Green lines indicate selection thresholds. (B) Plotted expression levels of these 8 IEGs show that their amplification by novel visual input depends on dopaminergic signaling. N = 6 mice per condition. All error bars indicate SEM.

Dopamine Neurons in the Ventral Midbrain Are Required for the Amplification of Arc mRNA During Early Postnatal Development of the Frontal Cortex

To determine whether dopamine neurons are required for the amplification of Arc mRNA during early postnatal development of the frontal cortex, we first sought to verify the presence of dopaminergic axons in the mouse frontal cortex during postnatal development. Previous studies in rats have shown that dopaminergic axons originated from cell bodies in the VTA of the midbrain reach the frontal cortex in the first postnatal week, concomitant with the completion of cortical layer differentiation (Verney et al. 1982; Kalsbeek et al. 1988). To examine the density of dopaminergic axons in the mouse frontal cortex over the subsequent developmental period, we immunostained frontal dopaminergic axons with an antibody specific for TH, an enzyme required for dopamine synthesis and abundantly expressed in those axons (Verney et al. 1982; Miner et al. 2003; Niwa et al. 2010). The specificity of this antibody for dopaminergic axons in the frontal cortex was confirmed by the disappearance of immunoactive signals after dopamine neuron ablation (supplementary fig. S4). Using this antibody, we found that dopaminergic innervation of the mouse frontal cortex was already present at P9, and the density of innervation increased significantly during postnatal development to reach a higher level by adulthood (one-way ANOVA, F(3,18) = 16.90, P < 0.0001, n = 4–8 mice per condition; Fig. 5A,B). The higher density of dopaminergic axons in adulthood is consistent with the higher level of Arc mRNA expression in adult frontal cortex.

Figure 5.

Figure 5.

Open in a new tab

Dopaminergic innervations in mouse frontal cortex increase during postnatal development. (A) Confocal images of coronal frontal cortical sections immunostained with TH-specific antibodies. Each panel is concatenated from 2 adjacent images. Scale bar is 250 µm. (B) Quantification of TH-immunoreactivity in the frontal cortex shows increased dopaminergic input during postnatal development (one-way ANOVA, F(3,18) = 16.90, P < 0.0001, n = 4–8 mice per condition). All error bars indicate SEM.

To further determine whether midbrain dopaminergic neurons are required for the amplification of Arc mRNA during early postnatal development of the frontal cortex, we used a catecholaminergic neurotoxin 6-hydroxydopamine (6-OHDA) to lesion dopaminergic neurons in the VTA (Cenci and Lundblad 2007). We injected 6-OHDA (5 μg per animal) unilaterally into the VTA of P9 mice and determined the extent of dopamine neuron loss at P19 by TH-immunostaining of VTA sections (Fig. 6A). We then processed the ipsilateral frontal cortices of brains with distinctive dopaminergic neuron loss for qRT-PCR analysis of Arc mRNA level. Our results showed that in lesioned mice, Arc mRNA expression was significantly lower than that in sham controls. In addition, the level of Arc mRNA expression in the frontal cortex of lesioned mice at P19 was comparable with that in normal mice at P9 (one-way ANOVA, F(3,10) = 12.35, P = 0.0011, n = 3–5 mice per condition; post-tests, OHDA P19 vs. Sham P19, P = 0.0059; OHDA P19 vs. normal P9, P = 0.9856; Fig. 6B). Our finding that damage to VTA dopaminergic neurons blocked the normal developmental increase of Arc mRNA expression in the frontal cortex suggests that developmental amplification of Arc mRNA requires dopaminergic neurons in the ventral midbrain.

Figure 6.

Figure 6.

Open in a new tab

Dopamine neurons in the ventral midbrain are required for amplification of Arc mRNA during early postnatal development of the frontal cortex. (A) Confocal image of TH-immunostaining in VTA of a P19 mouse, which received unilateral injection of 6-OHDA at P9, shows loss of TH+ neurons on the injected side (right). Scale bar is 300 µm. (B) At P19, the level of Arc mRNA expression in the frontal cortex was significantly lower in VTA-lesioned than in sham-operated mice, and remained at a level comparable with that in untreated P9 mice (one-way ANOVA, F(3,10) = 12.35, P = 0.0011, n = 3–5 mice per condition; post-tests, OHDA P19 vs. Sham P19, **P = 0.0059; OHDA P19 vs. normal P9, P = 0.9856; normal P9 vs. normal P19, *P = 0.0106).

Discussion

Using several lines of in vivo evidence, this study demonstrates that during early postnatal development of the frontal cortex, dopaminergic signaling is required for the amplification of Arc mRNA expression in response to neural activity. First, lesion of VTA dopamine neurons prevents the amplification of Arc expression during the early postnatal frontal cortical development. Second, inhibition of D1R blocks the amplification of Arc mRNA by visual experience at P13. Third, before eye-opening, D1R activation is required for the amplification of Arc expression in response to electrical stimuli. Those results therefore suggest that dopamine plays an essential role in the amplification of activity-dependent Arc expression in the early postnatal frontal cortex.

While dopaminergic signaling, including its modulatory effects on Arc expression, has been studied in adult brain (Fosnaugh et al. 1995; Tritsch and Sabatini 2012), far less attention has been paid to its role in early postnatal development of the frontal cortex (Money and Stanwood 2013). This study is the first to address the role of dopamine in the developmental amplification of neural activity-dependent Arc gene expression. Indeed, some in vitro cell culture studies have suggested that dopamine's role is negligible, and that in the absence of dopamine, electrical activation alone is sufficient to trigger Arc expression (Shepherd et al. 2006; Bloomer et al. 2008). Our in vivo findings, by contrast, indicate that during early postnatal frontal cortical development, electrical stimulation alone is not sufficient to amplify Arc mRNA expression. Instead, dopaminergic signaling is required for the amplification of neural activity-dependent Arc gene expression. In further contrast to this requirement of dopamine, a previous study has reported that neonatal norepinephrine lesions do not affect Arc expression in developing brain (Sanders et al. 2008). Finally, dopaminergic signaling is not only necessary for Arc induction in postnatal frontal cortex but also required for the induction of a list of other IEGs. Thus, our study defines a hitherto unrecognized essential role for the dopaminergic system in postnatal brain development.

Dopamine may affect multiple steps in activity-dependent gene expression, such as neuronal excitability, intracellular signaling, and chromatin accessibility (Seamans and Yang 2004; Tritsch and Sabatini 2012; Nestler 2014). Dopamine-induced changes at these steps may synergize with the electroconvulsive stimulus and lead to the amplification of Arc mRNA in P9 mice. Despite the lack of Arc induction, the electroconvulsive stimulus alone is sufficient to evoke limb movements in P9 mice, indicating that this stimulus is functionally effective in young mice. The difference between Arc activation patterns observed in postnatal frontal cortex and primary cell cultures (Shepherd et al. 2006; Bloomer et al. 2008), which were derived from embryonic hippocampal or cortical tissues, may stem from distinct anatomical and developmental origins of the cells under study. In addition, it has been reported that even in neurons of the same origin, chromatin accessibility can differ between the in vivo and the in vitro culture systems (Frank et al. 2015). It will be an interesting direction for future research to compare the signaling pathways and chromatin states for activity-dependent gene transcription in different experimental systems.

Our findings show that the most dramatic developmental increase in frontal cortical Arc expression occurs between P11 and P13, when mouse pups open their eyes and a flood of novel visual inputs arrive. Visual inputs can reach the frontal cortex through feed-forward glutamatergic circuits that connect the retina, the thalamus, the visual cortex, and the frontal cortex (Uylings et al. 2003). Moreover, novel visual stimuli are also potent activators of VTA dopaminergic neurons in rodents and primates, potentially through a direct connection from superior colliculus to VTA (Horvitz 2000; Dommett et al. 2005). This convergent activation of glutamatergic and dopaminergic circuits might underlie the requirement of dopamine for the developmental amplification of Arc mRNA in the frontal cortex. While our results showed that amphetamine and electrical stimulation act synergistically to amplify Arc expression in postnatal frontal cortex, whether this synergy occurs at a circuit level or at an intracellular signaling level or both remains unresolved (Dommett et al. 2005; Lyons and West 2011; Tritsch and Sabatini 2012). Future studies to optimize optogenetic and chemogenetic tools for neonatal brain application may help to further delineate the interplays between dopamine and electrical activity in the developmental amplification of Arc mRNA expression.

In a variety of species including mice and human, eye-opening, but not birth, indicates a comparable stage of cortical neural development (Workman et al. 2013). Human infants open their eyes after birth, and dramatic increases in Arc expression in the frontal cortex also occur at this stage (Colantuoni et al. 2011). Since dopaminergic inputs have been shown to reach human cerebral cortex before birth and to increase markedly thereafter (Berger et al. 1991), results from our mouse study raises the possibility that in developing human cortex, the amplification of activity-dependent Arc expression may be also modulated by dopaminergic inputs and sensitive to psychoactive drug exposure (Money and Stanwood 2013).

Previous research involving pharmacological or genetic inhibition of Arc expression has shown that lack of Arc expression disrupts both activity-dependent circuit maturation and synaptic remodeling linked to memory (Bramham et al. 2008; Korb and Finkbeiner 2011; Shepherd and Bear 2011; Mikuni et al. 2013). In the frontal cortex, particularly, our earlier studies have shown that Arc is required for the emergence of learning-related persistent firing patterns and neuronal ensemble consolidation (Ren et al. 2014; Cao et al. 2015). Here, we show that without dopaminergic signaling during postnatal development, Arc mRNA expression could not be induced. This lack of Arc expression from impaired dopaminergic signaling may therefore impair subsequent functions of frontal cortical circuits.

Perturbations of dopaminergic signaling have been associated with the pathogenesis or treatment of neurodevelopmental psychiatric disorders (Tritsch and Sabatini 2012; Slifstein et al. 2015). In parallel, Arc signaling complex has been shown as a target of mutations in neurodevelopmental psychiatric disorders such as schizophrenia (Fromer et al. 2014; Purcell et al. 2014; Hu et al. 2015; Huentelman et al. 2015). Our findings on the relationship between dopamine and Arc at an early life stage provide a novel intersection point between two disease-related molecular pathways. Furthermore, these findings suggest that combined electrical and dopaminergic activation is essential to establish the normal expression pattern of a schizophrenia-associated gene during frontal cortical development. This combinatorial strategy might be exploited to ameliorate gene expression deficits related to neurodevelopmental psychiatric disorders.

Supplementary Material

Supplementary material can be found at: http://www.cercor.oxfordjournals.org.

Funding

National Institute of Mental Health Division of Intramural Research Programs ZIA MH002897.

Supplementary Material

Supplementary Data
Click here for additional data file. (1.9MB, pdf)

Notes

We thank B. Lipska, J. Kleinman and D. Weinberger for scientific discussions, A. Jello, K. Louhiranta and W. Wu for technical assistance, and E. J. Sherman for technical editing. Conflict of Interest: None declared.

References

  1. Ackman JB, Burbridge TJ, Crair MC.. 2012. Retinal waves coordinate patterned activity throughout the developing visual system. Nature. 490:219–225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Berger B, Gaspar P, Verney C.. 1991. Dopaminergic innervation of the cerebral cortex: unexpected differences between rodents and primates. Trends Neurosci. 14:21–27. [DOI] [PubMed] [Google Scholar]
  3. Bloomer WA, VanDongen HM, VanDongen AM.. 2008. Arc/Arg3.1 translation is controlled by convergent N-methyl-D-aspartate and Gs-coupled receptor signaling pathways. J Biol Chem. 283:582–592. [DOI] [PubMed] [Google Scholar]
  4. Bramham CR, Worley PF, Moore MJ, Guzowski JF.. 2008. The immediate early gene arc/arg3.1: regulation, mechanisms, and function. J Neurosci. 28:11760–11767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cao VY, Ye Y, Mastwal S, Ren M, Coon M, Liu Q, Costa RM, Wang KH.. 2015. Motor learning consolidates arc-expressing neuronal ensembles in secondary motor cortex. Neuron. 86:1385–1392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cenci MA, Lundblad M.. 2007. Ratings of L-DOPA-induced dyskinesia in the unilateral 6-OHDA lesion model of Parkinson's disease in rats and mice. Curr Protoc Neurosci. 41:9.25.1–9.25.23. [DOI] [PubMed] [Google Scholar]
  7. Colantuoni C, Lipska BK, Ye T, Hyde TM, Tao R, Leek JT, Colantuoni EA, Elkahloun AG, Herman MM, Weinberger DR, et al. 2011. Temporal dynamics and genetic control of transcription in the human prefrontal cortex. Nature. 478:519–523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. de Bartolomeis A, Iasevoli F, Marmo F, Buonaguro EF, Eramo A, Rossi R, Avvisati L, Latte G, Tomasetti C.. 2015. Progressive recruitment of cortical and striatal regions by inducible postsynaptic density transcripts after increasing doses of antipsychotics with different receptor profiles: insights for psychosis treatment. Eur Neuropsychopharmacol. 25:566–582. [DOI] [PubMed] [Google Scholar]
  9. Dommett E, Coizet V, Blaha CD, Martindale J, Lefebvre V, Walton N, Mayhew JE, Overton PG, Redgrave P.. 2005. How visual stimuli activate dopaminergic neurons at short latency. Science. 307:1476–1479. [DOI] [PubMed] [Google Scholar]
  10. Fosnaugh JS, Bhat RV, Yamagata K, Worley PF, Baraban JM.. 1995. Activation of arc, a putative “effector” immediate early gene, by cocaine in rat brain. J Neurochem. 64:2377–2380. [DOI] [PubMed] [Google Scholar]
  11. Fox WM. 1965. Reflex-ontogeny and behavioural development of the mouse. Anim Behav. 13:234–241. [DOI] [PubMed] [Google Scholar]
  12. Frank CL, Liu F, Wijayatunge R, Song L, Biegler MT, Yang MG, Vockley CM, Safi A, Gersbach CA, Crawford GE, et al. 2015. Regulation of chromatin accessibility and Zic binding at enhancers in the developing cerebellum. Nat Neurosci. 18:647–656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. French PJ, O'Connor V, Voss K, Stean T, Hunt SP, Bliss TV.. 2001. Seizure-induced gene expression in area CA1 of the mouse hippocampus. Eur J Neurosci. 14:2037–2041. [DOI] [PubMed] [Google Scholar]
  14. Fromer M, Pocklington AJ, Kavanagh DH, Williams HJ, Dwyer S, Gormley P, Georgieva L, Rees E, Palta P, Ruderfer DM, et al. 2014. De novo mutations in schizophrenia implicate synaptic networks. Nature. 506:179–184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gil-Bea FJ, Solas M, Mateos L, Winblad B, Ramirez MJ, Cedazo-Minguez A.. 2011. Cholinergic hypofunction impairs memory acquisition possibly through hippocampal Arc and BDNF downregulation. Hippocampus. 21:999–1009. [DOI] [PubMed] [Google Scholar]
  16. Glue P, Costello MJ, Pert A, Mele A, Nutt DJ.. 1990. Regional neurotransmitter responses after acute and chronic electroconvulsive shock. Psychopharmacology (Berl). 100:60–65. [DOI] [PubMed] [Google Scholar]
  17. Guillozet-Bongaarts AL, Hyde TM, Dalley RA, Hawrylycz MJ, Henry A, Hof PR, Hohmann J, Jones AR, Kuan CL, Royall J, et al. 2014. Altered gene expression in the dorsolateral prefrontal cortex of individuals with schizophrenia. Mol Psychiatry. 19:478–485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Guo JU, Ma DK, Mo H, Ball MP, Jang MH, Bonaguidi MA, Balazer JA, Eaves HL, Xie B, Ford E, et al. 2011. Neuronal activity modifies the DNA methylation landscape in the adult brain. Nat Neurosci. 14:1345–1351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Guzowski JF, McNaughton BL, Barnes CA, Worley PF.. 1999. Environment-specific expression of the immediate-early gene Arc in hippocampal neuronal ensembles. Nat Neurosci. 2:1120–1124. [DOI] [PubMed] [Google Scholar]
  20. Horvitz JC. 2000. Mesolimbocortical and nigrostriatal dopamine responses to salient non-reward events. Neuroscience. 96:651–656. [DOI] [PubMed] [Google Scholar]
  21. Hu J, Sathanoori M, Kochmar S, Azage M, Mann S, Madan-Khetarpal S, Goldstein A, Surti U.. 2015. A novel maternally inherited 8q24.3 and a rare paternally inherited 14q23.3 CNVs in a family with neurodevelopmental disorders. Am J Med Genet A. 167A:1921–1926. [DOI] [PubMed] [Google Scholar]
  22. Huentelman MJ, Muppana L, Corneveaux JJ, Dinu V, Pruzin JJ, Reiman R, Borish CN, De Both M, Ahmed A, Todorov A, et al. 2015. Association of SNPs in EGR3 and ARC with Schizophrenia Supports a Biological Pathway for Schizophrenia Risk. PLoS One. 10:e0135076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Huttenlocher PR, Dabholkar AS.. 1997. Regional differences in synaptogenesis in human cerebral cortex. J Comp Neurol. 387:167–178. [DOI] [PubMed] [Google Scholar]
  24. Kalsbeek A, Voorn P, Buijs RM, Pool CW, Uylings HB.. 1988. Development of the dopaminergic innervation in the prefrontal cortex of the rat. J Comp Neurol. 269:58–72. [DOI] [PubMed] [Google Scholar]
  25. Khazipov R, Luhmann HJ.. 2006. Early patterns of electrical activity in the developing cerebral cortex of humans and rodents. Trends Neurosci. 29:414–418. [DOI] [PubMed] [Google Scholar]
  26. Kirov G, Pocklington AJ, Holmans P, Ivanov D, Ikeda M, Ruderfer D, Moran J, Chambert K, Toncheva D, Georgieva L, et al. 2012. De novo CNV analysis implicates specific abnormalities of postsynaptic signalling complexes in the pathogenesis of schizophrenia. Mol Psychiatry. 17:142–153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Korb E, Finkbeiner S.. 2011. Arc in synaptic plasticity: from gene to behavior. Trends Neurosci. 34:591–598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Leslie CA, Robertson MW, Cutler AJ, Bennett JP Jr.. 1991. Postnatal development of D1 dopamine receptors in the medial prefrontal cortex, striatum and nucleus accumbens of normal and neonatal 6-hydroxydopamine treated rats: a quantitative autoradiographic analysis. Brain Res Dev Brain Res. 62:109–114. [DOI] [PubMed] [Google Scholar]
  29. Lewis DA, Levitt P.. 2002. Schizophrenia as a disorder of neurodevelopment. Annu Rev Neurosci. 25:409–432. [DOI] [PubMed] [Google Scholar]
  30. Lin Y, Bloodgood BL, Hauser JL, Lapan AD, Koon AC, Kim TK, Hu LS, Malik AN, Greenberg ME.. 2008. Activity-dependent regulation of inhibitory synapse development by Npas4. Nature. 455:1198–1204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Link W, Konietzko U, Kauselmann G, Krug M, Schwanke B, Frey U, Kuhl D.. 1995. Somatodendritic expression of an immediate early gene is regulated by synaptic activity. Proc Natl Acad Sci U S A. 92:5734–5738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lyford GL, Yamagata K, Kaufmann WE, Barnes CA, Sanders LK, Copeland NG, Gilbert DJ, Jenkins NA, Lanahan AA, Worley PF.. 1995. Arc, a Growth-Factor and Activity-Regulated Gene, Encodes a Novel Cytoskeleton-Associated Protein That Is Enriched in Neuronal Dendrites. Neuron. 14:433–445. [DOI] [PubMed] [Google Scholar]
  33. Lyons MR, West AE.. 2011. Mechanisms of specificity in neuronal activity-regulated gene transcription. Prog Neurobiol. 94:259–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Ma DK, Jang MH, Guo JU, Kitabatake Y, Chang ML, Pow-Anpongkul N, Flavell RA, Lu B, Ming GL, Song H.. 2009. Neuronal activity-induced Gadd45b promotes epigenetic DNA demethylation and adult neurogenesis. Science. 323:1074–1077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Mastwal S, Ye Y, Ren M, Jimenez DV, Martinowich K, Gerfen CR, Wang KH.. 2014. Phasic dopamine neuron activity elicits unique mesofrontal plasticity in adolescence. J Neurosci. 34:9484–9496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Mikuni T, Uesaka N, Okuno H, Hirai H, Deisseroth K, Bito H, Kano M.. 2013. Arc/Arg3.1 is a postsynaptic mediator of activity-dependent synapse elimination in the developing cerebellum. Neuron. 78:1024–1035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Miner LH, Schroeter S, Blakely RD, Sesack SR.. 2003. Ultrastructural localization of the norepinephrine transporter in superficial and deep layers of the rat prelimbic prefrontal cortex and its spatial relationship to probable dopamine terminals. J Comp Neurol. 466:478–494. [DOI] [PubMed] [Google Scholar]
  38. Money KM, Stanwood GD.. 2013. Developmental origins of brain disorders: roles for dopamine. Front cell Neurosci. 7:260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Nestler EJ. 2014. Epigenetic mechanisms of drug addiction. Neuropharmacology. 76 Pt B:259–268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Niwa M, Kamiya A, Murai R, Kubo K, Gruber AJ, Tomita K, Lu L, Tomisato S, Jaaro-Peled H, Seshadri S, et al. 2010. Knockdown of DISC1 by in utero gene transfer disturbs postnatal dopaminergic maturation in the frontal cortex and leads to adult behavioral deficits. Neuron. 65:480–489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. O'Donovan KJ, Tourtellotte WG, Millbrandt J, Baraban JM.. 1999. The EGR family of transcription-regulatory factors: progress at the interface of molecular and systems neuroscience. Trends Neurosci. 22:167–173. [DOI] [PubMed] [Google Scholar]
  42. Pei Q, Lewis L, Sprakes ME, Jones EJ, Grahame-Smith DG, Zetterstrom TSC.. 2000. Serotonergic regulation of mRNA expression of Arc, an immediate early gene selectively localized at neuronal dendrites. Neuropharmacology. 39:463–470. [DOI] [PubMed] [Google Scholar]
  43. Purcell SM, Moran JL, Fromer M, Ruderfer D, Solovieff N, Roussos P, O'Dushlaine C, Chambert K, Bergen SE, Kahler A, et al. 2014. A polygenic burden of rare disruptive mutations in schizophrenia. Nature. 506:185–190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Rapoport JL, Giedd JN, Gogtay N.. 2012. Neurodevelopmental model of schizophrenia: update 2012. Mol Psychiatry. 17:1228–1238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Ren M, Cao V, Ye Y, Manji HK, Wang KH.. 2014. Arc regulates experience-dependent persistent firing patterns in frontal cortex. J Neurosci. 34:6583–6595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Rosenberg DR, Lewis DA.. 1995. Postnatal maturation of the dopaminergic innervation of monkey prefrontal and motor cortices: a tyrosine hydroxylase immunohistochemical analysis. J Comp Neurol. 358:383–400. [DOI] [PubMed] [Google Scholar]
  47. Sanders JD, Happe HK, Bylund DB, Murrin LC.. 2008. Differential effects of neonatal norepinephrine lesions on immediate early gene expression in developing and adult rat brain. Neurosci. 157:821–832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Seamans JK, Yang CR.. 2004. The principal features and mechanisms of dopamine modulation in the prefrontal cortex. Prog Neurobiol. 74:1–58. [DOI] [PubMed] [Google Scholar]
  49. Shepherd JD, Bear MF.. 2011. New views of Arc, a master regulator of synaptic plasticity. Nat Neurosci. 14:279–284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Shepherd JD, Rumbaugh G, Wu J, Chowdhury S, Plath N, Kuhl D, Huganir RL, Worley PF.. 2006. Arc/Arg3.1 mediates homeostatic synaptic scaling of AMPA receptors. Neuron. 52:475–484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Slifstein M, van de Giessen E, Van Snellenberg J, Thompson JL, Narendran R, Gil R, Hackett E, Girgis R, Ojeil N, Moore H, et al. 2015. Deficits in prefrontal cortical and extrastriatal dopamine release in schizophrenia: a positron emission tomographic functional magnetic resonance imaging study. JAMA psychiatry. 72:316–324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Soule J, Alme M, Myrum C, Schubert M, Kanhema T, Bramham CR.. 2012. Balancing Arc synthesis, mRNA decay, and proteasomal degradation: maximal protein expression triggered by rapid eye movement sleep-like bursts of muscarinic cholinergic receptor stimulation. J Biol Chem. 287:22354–22366. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Sulzer D, Sonders MS, Poulsen NW, Galli A.. 2005. Mechanisms of neurotransmitter release by amphetamines: a review. Prog Neurobiol. 75:406–433. [DOI] [PubMed] [Google Scholar]
  54. Sur M, Rubenstein JL.. 2005. Patterning and plasticity of the cerebral cortex. Science. 310:805–810. [DOI] [PubMed] [Google Scholar]
  55. Tritsch NX, Sabatini BL.. 2012. Dopaminergic modulation of synaptic transmission in cortex and striatum. Neuron. 76:33–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Tye KM, Deisseroth K.. 2012. Optogenetic investigation of neural circuits underlying brain disease in animal models. Nat Rev Neurosci. 13:251–266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Uylings HB, Groenewegen HJ, Kolb B.. 2003. Do rats have a prefrontal cortex. Behav Brain Res. 146:3–17. [DOI] [PubMed] [Google Scholar]
  58. Verney C, Berger B, Adrien J, Vigny A, Gay M.. 1982. Development of the dopaminergic innervation of the rat cerebral cortex. A light microscopic immunocytochemical study using anti-tyrosine hydroxylase antibodies. Brain Res. 281:41–52. [DOI] [PubMed] [Google Scholar]
  59. Wang KH, Majewska A, Schummers J, Farley B, Hu C, Sur M, Tonegawa S.. 2006. In vivo two-photon imaging reveals a role of arc in enhancing orientation specificity in visual cortex. Cell. 126:389–402. [DOI] [PubMed] [Google Scholar]
  60. West AE, Greenberg ME.. 2011. Neuronal activity-regulated gene transcription in synapse development and cognitive function. Cold Spring Harb Perspect Biol. 3:1–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Wood J, Kim Y, Moghaddam B.. 2012. Disruption of prefrontal cortex large scale neuronal activity by different classes of psychotomimetic drugs. J Neurosci. 32:3022–3031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Workman AD, Charvet CJ, Clancy B, Darlington RB, Finlay BL.. 2013. Modeling transformations of neurodevelopmental sequences across mammalian species. J Neurosci. 33:7368–7383. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Data
Click here for additional data file. (1.9MB, pdf)

Articles from Cerebral Cortex (New York, NY) are provided here courtesy of Oxford University Press

RESOURCES