| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse monoclonal anti-MAP2 | Sigma Aldrich | Catalog number M4403; RRID: AB_477193 |
| Rabbit polyclonal anti-TAU | Synaptic System | Catalog number 314 002; RRID: AB_993042 |
| Mouse monoclonal anti-SMI32 | Abcam | Catalog number ab7795; RRID: AB_306084 |
| Rabbit polyclonal anti-MNX1 (HB9) | Merck Millipore | Catalog number ABN174; RRID: AB_2732012 |
| Mouse monoclonal anti-HUD (E-1) | Santa Cruz Biotechnology | Catalog number sc-28299; RRID: AB_627765 |
| Mouse monoclonal Anti-β-Tubulin III | Sigma Aldrich | Catalog number T8578; RRID: AB_1841228 |
| Mouse monoclonal anti-eEF1A1, clone CBP-KK1 | Merck Millipore | Catalog number 05-235; RRID: AB_309663 |
| Rabbit polyclonal anti eIF4A2 | Abcam | Catalog number ab31218; RRID: AB_732123 |
| Rabbit polyclonal anti-PABP | Abcam | Catalog number ab21060; RRID: AB_777008 |
| Mouse monoclonal anti-DCP1A | Abcam | Catalog number ab57654; RRID: AB_942144 |
| Mouse monoclonal Anti-TIA-1 | Santa Cruz Biotechnology | Catalog number sc-166247; RRID: AB_2201545 |
| Mouse monoclonal anti-Oct4 (C-10) | Santa Cruz Biotechnology | Catalog number sc-5279; RRID: AB_628051 |
| Mouse monoclonal anti-Nestin, (clone rat-401) | Merck Millipore | Catalog number MAB353; RRID: AB_94911 |
| Mouse monoclonal anti-β-Tubulin III | Promega | Catalog number G712A |
| Goat anti-Rabbit IgG (H+L) polyclonal, Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Thermo Fisher Scientific | Catalog number A-11008; RRID: AB_143165 |
| Goat anti-Rabbit IgG (H+L) polyclonal, Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 | Thermo Fisher Scientific | Catalog number A-11012; RRID: AB_2534079 |
| F(ab)2-Goat anti-Mouse IgG (H+L) polyclonal, Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Thermo Fisher Scientific | Catalog number A-11017; RRID: AB_2534084 |
| F(ab)2-Goat anti-Mouse IgG (H+L) polyclonal, Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 | Thermo Fisher Scientific | Catalog number A-11020; RRID: AB_2534087 |
| Donkey anti-Rabbit IgG (H+L) polyclonal, Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Thermo Fisher Scientific | Catalog number A-21206; RRID: AB_2535792 |
| Donkey anti-Goat IgG (H+L) polyclonal, preadsorbed Secondary Antibody, Alexa Fluor 594 | Abcam | Catalog number ab150136 |
| mouse monoclonal anti-β-tubulin (3F3-G2) | Santa Cruz Biotechnology | Catalog number sc-53140; RRID: AB_793543 |
| Rabbit polyclonal anti-HA | Bethyl laboratories | Catalog number A190-108A; RRID: AB_67465 |
| Rabbit polyclonal anti-eIF4A1 | Abcam | Catalog number ab31217; RRID: AB_732122 |
| Rabbit anti-eIF4A3 | Home made by Prof. Macchi’s Lab | |
| Rabbit polyclonal anti-eEF1A1 | Sigma Aldrich | Catalog number SAB2108050 |
| Rabbit polyclonal anti-PABPC1 | Sigma Aldrich | Catalog number SAB2101708; RRID: AB_10604467 |
| Rabbit polyclonal anti-Rpl26 | Abcam | Catalog number ab59567; RRID: AB_945306 |
| Rabbit monoclonal anti-S6 | Cell Signaling Technology | Catalog number 2217; RRID: AB_331355 |
| Bacterial and Virus Strains | ||
| XL1 Blue | Stratagene | Catalog number 200249 |
| DH5alpha | This study | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Doxycycline | Sigma-Aldrich | Catalog number A3656 |
| Torin1 | EMD MILLIPORE | Catalog number 475991 |
| Sodium arsenite solution | EMD MILLIPORE | Catalog number 1.06277 |
| Cycloheximide (CHX) | Sigma-Aldrich | Catalog number C7698 |
| Phorbol 12-myristate 13-acetate (PMA) | Sigma-Aldrich | Catalog number P8139 |
| Dimethyl Sulfoxide (DMSO) | Fisher Scientific | Catalog number BP2311 |
| NGF | Sigma-Aldrich | Catalog number N6009 |
| GDNF | Peprotec | Catalog number 450-44-10 |
| CNTF | Peprotec | Catalog number 450-13-10 |
| BDNF | Peprotec | Catalog number 450-02-10 |
| Collagen type IV | Sigma-Aldrich | Catalog number C5533 |
| Laminin Mouse Protein, Natural | Thermo Fisher Scientific | Catalog number 23017015 |
| Lectin Sigma L9640 | Sigma-Aldrich | Catalog number L9640 |
| Poly-DL-ornithine hydrobromide | Sigma-Aldrich | Catalog number P8638 |
| Recombinant His-HuD protein | This study | N/A |
| Critical Commercial Assays | ||
| Pierce Anti-HA Magnetic Beads | Thermo Fisher Scientific | Catalog number 88836 |
| IBA Lifesciences Ni-NTA Superflow | Fisher Scientific | Catalog number 2-3206-025 |
| Pierce Anti-HA Agarose Beads | Thermo Fisher Scientific | Catalog number 26181 |
| Streptavidin MyOne T1 beads | Thermo Fisher Scientific | Catalog number 65601 |
| ECL Prime Western Blotting System GE Healthcare | Sigma-Aldrich | Catalog number GERPN2232 |
| Bradford Reagent | Sigma-Aldrich | Catalog number B6916 |
| Lipofectamine RNAiMAX Reagent | Thermo Fisher Scientific | Catalog number 13778030 |
| Lipofectamine 2000 | Thermo Fisher Scientific | Catalog number 11668027 |
| Dual-Glo Luciferase Assay System | Promega | Catalog number E2920 |
| Retinoic acid | Sigma-Aldrich | Catalog number R2625 |
| Click-iT AHA Alexa Fluor Protein Synthesis HCS Assay | Thermo Fisher Scientific | Catalog number C10289 |
| Hoechst 33342 | Thermo Fisher Scientific | Catalog number 62249 |
| Starting Kit: Magnetic Plate + NeuroMag 200 μL | OZ Bioscience | Catalog number KC30800 |
| AlphaScreen HA (Hemagglutinin) Detection Kit | PerkinElmer | Catalog number 6760612C |
| TruSeq Stranded mRNA Library Prep | Illumina | Catalog number 20020594 |
| TruSeq Targeted RNA Custom Panel Kit | Illumina | Catalog number RT-101-1001 |
| QuantSeq 3′ mRNA-Seq Library Prep Kit REV | Lexogen | Catalog number 016.24 |
| iScriptcDNA synthesis kit | Biorad | Catalog number 1708891 |
| KAPA SYBR FAST Universal 2X qPCR Master Mix | Kapa Biosystems | Catalog number KK4601 – 07959389001 |
| Deposited Data | ||
| Raw Imaging files | This study, Mendeley Data | https://doi.org/10.17632/p34w7w78hy.1 |
| Sequence files | This study, GEO GSE115490 | https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE115490 |
| Reference mouse genome annotation Gencode M6 | Gencode | https://www.gencodegenes.org/mouse_releases/6.html |
| Experimental Models: Cell Lines | ||
| H. sapiens: HEK293T | Quattrone A. Lab (CIBIO) | RRID: CVCL_0045 |
| M. musculus: NSC34 | Tebu-bio | RRID: CVCL_D356 |
| M. musculus: NSC-34-Trex | This study | N/A |
| M. musculus: NSC-34-HuD | This study | N/A |
| M. musculus: NSC-34-shHuD | This study | N/A |
| R. norvegicus: PC12 | Quattrone A.Lab (CIBIO) | RRID: CVCL_0481 |
| M. musculus: 46C ES | Conti L. Lab (CIBIO) | RRID: CVCL_Y482 |
| H. sapiens: CRISPR Knockout Ro60 ES2, Clone 1 | Huettelmaier S. Lab | N/A |
| H. sapiens: CRISPR Knockout Ro60 ES2, Clone 1 | Huettelmaier S. Lab | N/A |
| Experimental Models: Organisms/Strains | ||
| C57BL/6J mice | The Jackson Laboratory | Catalog number 000664; RRID: IMSR_JAX:000664 |
| Oligonucleotides | ||
| See Table S2 for complete list of primers used for qPCR analysis and barcodes used for CRAC | This study | N/A |
| Y3 siRNA AACUAAUUGAUCACAACCAGU | Köhn et al., 2015 | N/A |
| Ctrl siRNA AGGUAGUGUAAUCGCCUUG | This study | N/A |
| HuD siRNA | Santa Cruz Biotechnology | Catalog number sc-37836 |
| Control siRNA | Santa Cruz Biotechnology | Catalog number sc-37007 |
| Y1 Northern Blot probe, ATAACTCACTACCTTCGGA CCAGCC |
Köhn et al., 2015 | N/A |
| Y3 Northern Blot probe, CTGTAACTGGTTGTGATCA ATTAGT |
Köhn et al., 2015 | N/A |
| Biotinylated ARE RNA AUUAUUUAUUAUUUAUUUA UUAUUUA |
This study | N/A |
| Biotinylated mY1 RNA, GGCTGGTCCGAAGGTAGTG AGTTATCTCAATTGATTGTTCACAGTCAGTTACAGAT TGAACTCCTGTTCTACACTTTCCCCCCTTCTCACTA CTGCACTTGACTAGTCTTTT |
Köhn et al., 2015 | N/A |
| Biotinylated mY3 RNA, GGTTGGTCCGAGAGTAGTG GTGTTTACAACTAATTGATCACAACCAGTTACAGAT TTCTTTGTTCCTTCTCCGCTCCCACTGCTTCACTT GACCAGCCTTTT |
Köhn et al., 2015 | N/A |
| Biotinylated hY4 RNA, GGCTGGTCCGATGGTAGTG GGTTATCAGAACTTATTAACATTAGTGTCACTAAAG TTGGTATACAACCCCCCACTGCTAAATTTGACTG GCTTTTT |
Köhn et al., 2015 | N/A |
| Recombinant DNA | ||
| pCMV6-AN-His-HA | Origene | Catalog number PS100017 |
| pCMV6-His-HA-HuD | This study | N/A |
| pCMV6-His-HA-HuD (R248K) | This study | N/A |
| pLenti CMV/TO His-HA-HuD | This study | N/A |
| pGEM-T-Y3wt | Köhn et al., 2015 | N/A |
| pGEM-T-Y3mut (mutant lacking the HuD binding motif) | This study | N/A |
| pT7-HuD-WT | Fukao et al., 2009 | N/A |
| pT7-HuD-MUT(mutant lacking any RNA-binding activity | Fukao et al., 2009 | N/A |
| pT7-HuD-14-302 | Fukao et al., 2009 | N/A |
| pT7-HuD-216-385 | Fukao et al., 2009 | N/A |
| pIS1-Eef25UTR-TOPwt | Thoreen et al., 2012, A | Addgene Plasmid, Catalog number 38235 |
| pIS1-Eef25UTR-TOPmut | Thoreen et al., 2012, A | Addgene Plasmid, Catalog number 38236 |
| pIS1-Eef25UTR-TOPwt-3′UTR Eef1a1 | This study | N/A |
| pIS1-Eef25UTR-TOPmut-3′UTR Eif4a3 | This study | N/A |
| pIS1-Eef25UTR-TOPwt-3′UTR Eef1a1 | This study | N/A |
| pIS1-Eef25UTR-TOPmut-3′UTR Eif4a3 | This study | N/A |
| pHuD-GFP vector | Fallini et al., 2011 | N/A |
| pshHuD | This study | N/A |
| pshY3 | This study | N/A |
| pCDNA-SBP-HuD | This study | N/A |
| Software and Algorithms | ||
| Prism | GraphPad, v5 | https://www.graphpad.com/ |
| Harmony software version 4.1 | PerkinElmer | N/A |
| ImageJ software version 1.43u | NIH | https://imagej.nih.gov/ij/ |
| Microscope Software Zen 2012 (Blue Edition) | Zeiss | https://www.zeiss.com/ |
| Adobe Photoshop 7.0 | Adobe Systems Incorporated | https://www.adobe.com/products/photoshop.html |
| hyb | https://github.com/gkudla/hyb | N/A |
| Tophat (version 2.0.14) | http://ccb.jhu.edu/software/tophat/index.shtml | N/A |
| R | https://www.r-project.org/ | N/A |
| STAR (version 2.5.3a) | https://github.com/alexdobin/STAR | N/A |
| Bioconductor | https://www.bioconductor.org/ | N/A |
| enrichR | http://amp.pharm.mssm.edu/Enrichr/ | N/A |
| Other | ||
| Stratalinker UV crosslinker 1800 | Stratagene | N/A |
| UA-6 UV/VIS detector | Teledyne Isco | N/A |
| High Content Screening System Operetta | PerkinElmer | N/A |