Table 1.

Mature miR172s and corresponding genes in barley

sRNA sequence (5′–3′)	Length	No. of reads	RPMa	Target site in cly1b	Penaltyc	Mature miR172 identityd	Gened	WGS contig IDe	Chromosomee
GGAAUCUUGAUGAUGCUGCAU	21	6693	70.9	1850–1870	3	miR172a	Hv-miR172a	Contig_38787	3HL
AGAAUCUUGAUGAUGCUGCAU	21	2036	21.6	1850–1870	4	miR172b	Hv-miR172b	Contig_49738	6HL
GGAAUCUUGAUGAUGCUGCA	20	118	1.3	1851–1870	2	miR172c	Hv-miR172c	Contig_1561881	7HS

^aReads per million; 10⁶ × number of reads/total number of reads.

^bPosition of the cly1 full-length cDNA (accession number KJ363931.1) aligned with miR172.

^cPenalty score of each miRNA for the cly1 is shown, calculated as 0.5 points assigned to each G:U wobble, 1 point to each non-G:U mismatch and 2 points to each bulged nucleotide in either RNA strand.

^dIDs given in the present study.

^eBased on miR172 isoform alignment to ‘Morex’ whole-genome sequencing contigs with no mismatches.