CapC, a Novel Autotransporter and Virulence Factor of Campylobacter jejuni

Jai W Mehat; Simon F Park; Arnoud H M van Vliet; Roberto M La Ragione

doi:10.1128/AEM.01032-18

. 2018 Aug 1;84(16):e01032-18. doi: 10.1128/AEM.01032-18

CapC, a Novel Autotransporter and Virulence Factor of Campylobacter jejuni

Jai W Mehat ^a,^✉, Simon F Park ^b, Arnoud H M van Vliet ^a, Roberto M La Ragione ^a,^✉

Editor: Johanna Björkroth^c

PMCID: PMC6070749 PMID: 29915112

Campylobacter jejuni is a major causative agent of human gastroenteritis, making this zoonotic pathogen of significant importance to human and veterinary public health worldwide. The mechanisms by which C. jejuni interacts with intestinal epithelial cells and causes disease are still poorly understood due, in part, to the heterogeneity of C. jejuni infection biology. Given the importance of C. jejuni to public health, the need to characterize novel and existing virulence mechanisms is apparent. The significance of our research is in demonstrating the role of CapC, a novel virulence factor in C. jejuni that contributes to adhesion and invasion of the intestinal epithelium, thereby in part, addressing the dearth of knowledge concerning the factors involved in Campylobacter pathogenesis and the variation observed in the severity of human infection.

KEYWORDS: Campylobacter, autotransporter proteins, virulence determinants

ABSTRACT

Campylobacter jejuni is recognized as an important causative agent of bacterial gastroenteritis in the developed world. Despite the identification of several factors contributing to infection, characterization of the virulence strategies employed by C. jejuni remains a significant challenge. Bacterial autotransporter proteins are a major class of secretory proteins in Gram-negative bacteria, and notably, many autotransporter proteins contribute to bacterial virulence. The aim of this study was to characterize the C. jejuni 81116 C8J_1278 gene (capC), predicted to encode an autotransporter protein, and examine the contribution of this factor to virulence of C. jejuni. The predicted CapC protein has a number of features that are consistent with autotransporters, including the N-terminal signal sequence and the C-terminal β-barrel domain and was determined to localize to the outer membrane. Inactivation of the capC gene in C. jejuni 81116 and C. jejuni M1 resulted in reduced insecticidal activity in Galleria mellonella larvae. Furthermore, C. jejuni capC mutants displayed significantly reduced adherence to and invasion of nonpolarized, partially differentiated Caco-2 and T84 intestinal epithelial cells. Gentamicin treatment showed that the reduced invasion of the capC mutant is primarily caused by reduced adherence to intestinal epithelial cells, not by reduced invasion capability. C. jejuni capC mutants caused reduced interleukin 8 (IL-8) secretion from intestinal epithelial cells and elicited a significantly diminished immune reaction in Galleria larvae, indicating that CapC functions as an immunogen. In conclusion, CapC is a new virulence determinant of C. jejuni that contributes to the integral infection process of adhesion to human intestinal epithelial cells.

IMPORTANCE Campylobacter jejuni is a major causative agent of human gastroenteritis, making this zoonotic pathogen of significant importance to human and veterinary public health worldwide. The mechanisms by which C. jejuni interacts with intestinal epithelial cells and causes disease are still poorly understood due, in part, to the heterogeneity of C. jejuni infection biology. Given the importance of C. jejuni to public health, the need to characterize novel and existing virulence mechanisms is apparent. The significance of our research is in demonstrating the role of CapC, a novel virulence factor in C. jejuni that contributes to adhesion and invasion of the intestinal epithelium, thereby in part, addressing the dearth of knowledge concerning the factors involved in Campylobacter pathogenesis and the variation observed in the severity of human infection.

INTRODUCTION

Campylobacter jejuni is a Gram-negative, microaerophilic bacterium that is recognized as the foremost cause of bacterial foodborne gastroenteritis worldwide (1). Infection is often self-limiting and is frequently acquired through the consumption of contaminated poultry and poultry products. It is estimated that Campylobacter causes 1.3 million cases of food poisoning in the United States and 280,000 cases in the United Kingdom each year (2). Moreover, campylobacteriosis poses a heavy economic burden, costing the U.S. economy an estimated $1.7 billion per annum and the U.K. economy an estimated £900 million per annum (3, 4).

The availability of a wealth of genomic information and the development of molecular tools for the study of Campylobacter has led to the identification of several factors integral to human infection and chicken colonization (5 –7).

C. jejuni transiently colonizes the human intestinal tract, causing a mild watery diarrhea but can also cause a more severe inflammatory and bloody diarrhea (7 –10). These diverse clinical manifestations may reflect differences in the virulence potential of C. jejuni isolates. The processes of adhesion to, invasion of, and translocation across the intestinal epithelium have been shown to be essential requirements to determine the pathogenicity of C. jejuni, yet the mechanisms C. jejuni uses for adhesion and invasion and whether these processes are intrinsically related are not entirely understood (11, 12). C. jejuni isolates have been shown to vary considerably in their abilities to both adhere and invade intestinal epithelial cells (13, 14). There is also a degree of variation reported in the translocation potential of C. jejuni and inconsistencies as to the route by which C. jejuni crosses the epithelium (15). Furthermore, different C. jejuni genotypes vary in their infection biology of the chicken host (13, 16); these inconsistencies may reflect various infection capabilities of different genotypes.

In excess of 40 genetic factors have been reported to contribute to C. jejuni adhesion and invasion (17). The precise influence and relative importance of each of these pathogenicity-associated factors to adhesion, invasion, and translocation of C. jejuni at the epithelial interface are unknown however. A clearer understanding of all of the factors contributing to this interaction is required to clarify the events during C. jejuni adhesion to and invasion of enterocytes in order to understand variation in virulence and clinical manifestation.

Bacterial autotransporters are the largest and most diverse class of surface-exposed or secreted proteins in Gram-negative bacteria (18, 19). These proteins share a mechanism of export, conferred by their C-terminal β-barrel structure, and play a wide variety of roles in pathogenesis and virulence conferred by their N-terminal functional or “passenger” domain (20). Significantly, all characterized autotransporter proteins are implicated in virulence to some extent (18). Notable autotransporters include the following: the Bordetella pertussis protein pertactin, a key component of epitopes included in the whooping cough vaccine (21); Yap proteins in Yersinia pestis and VacA; and the pore-forming, vacuolating cytotoxin in Helicobacter pylori (18).

The capA (cj0628/9) and capB (cj1677/8) genes of C. jejuni NCTC 11168 were the first two autotransporters identified in C. jejuni (22). CapA has been shown to contribute to adherence to Caco-2 cells and chicken LHM cells, and the absence of CapA has been shown to contribute to impaired colonization of chickens (22). However, a separate study concluded that CapA had no effect on broiler colonization (5). Furthermore, the capA gene is not present in all C. jejuni isolates, so it is likely dispensable (5), and no discernible role has been ascribed to CapB (5). These autotransporters are absent in C. jejuni M1 and C. jejuni 81116 (NCTC 11828), two other reference strains that were isolated from chickens and humans, respectively (23 –25). In the absence of capA and capB, these strains can be expected to carry genes that encode other genetic factors to compensate.

Here, we characterized another putative autotransporter-encoding gene, the C. jejuni 81116 C8J_1278 locus (26), which bears no sequence identity with other autotransporters identified in C. jejuni and this autotransporter has been tentatively named CapC. Given the plethora of literature citing the involvement of autotransporters in virulence (18, 22, 27 –30), we hypothesized that CapC serves as a virulence determinant in C. jejuni, and here, we show data supporting this hypothesis.

RESULTS

Characterization of a novel Campylobacter autotransporter protein.

The predicted protein sequence encoded by capC (GenBank accession no. ABV52877.1) was used to identify potential conserved domains using the NCBI Conserved Domain Database (CDD). The CDD query tool allowed the identification of structural motifs in the C-terminal thirds of the CapC sequence (residues 490 to 750). The CDD search successfully identified an autotransporter beta-domain in this region that was found in all autotransporter proteins, thus denoting CapC as a member of this family (Fig. 1). The SignalP 4.1 server was successfully utilized to predict the presence and location of a signal peptide sequence motif in the CapC amino acid sequence. The first 25 amino acids in the CapC sequence represent the N-terminal signal sequence of this autotransporter, and this sequence is cleaved after this residue. The subcellular localization prediction tool Cello V2.5 is commonly used to predict the localization of prokaryotic and eukaryotic proteins. Use of the Cello localization tool suggests that CapC is ultimately an extracellular, secreted protein. An alternative localization prediction tool is PSORTb. CapC is predicted by PSORTb to be primarily an outer membrane protein, as one might expect from an autotransporter; however, there was a lower prediction score for the likelihood of CapC being an extracellular protein. Phyre2 was successfully used in this study to build a partial three-dimensional (3D) model of the CapC protein based on remote homology detection methods. The model of the CapC protein structure shows the clearly defined 14 amphipathic strands comprising the beta-barrel that is characteristic of all autotransporters, further confirming CapC as a member of this family. Outputs from these analyses are shown in Fig. S1A to S1C and Table S1 in the supplemental material (31 –34).

FIG 1 — Analysis of CapC domains using the Conserved Domain Database query. The C-terminal third of the CapC protein sequence is shown to possess an autotransporter domain, confirming that CapC is a member of the autotransporter family. Query seq., query sequence.

capC encodes an outer membrane protein that does not affect C. jejuni growth.

Antibodies against a CapC-specific peptide were raised in rabbits. Crude rabbit sera recognized an ∼43-kDa protein in whole-cell preparations (Fig. 2A). Interestingly, an additional protein band was detected at ∼25 kDa, which may represent a folded form of CapC. Only the ∼43-kDa CapC protein was detected in the outer membrane fractions of wild-type C. jejuni 81116 and C. jejuni M1 (Fig. 2B and C), indicating that CapC is an outer membrane-anchored protein and does not appear to be secreted extracellularly in its native form. Anti-major outer membrane protein (anti-MOMP) antibodies were used as positive controls and to ensure purity of outer membrane fractions (Fig. S2) (35).

To assess the role of CapC in C. jejuni, isogenic mutants of capC were constructed in C. jejuni 81116 and C. jejuni M1 by insertion of a chloramphenicol resistance cassette. We were unable to complement the capC mutants, as we were unable to clone the capC coding sequence into the pC46 or pSV009 complementation vector in the correct orientation, despite repeated attempts (36 –38).

The capC mutants lacked expression of CapC as determined by immunoblotting (Fig. 2A), and inactivation of capC did not affect growth of C. jejuni or reduce capability to survive exposure to aerobic conditions (Fig. S3 and S4).

Inactivation of capC causes decreased virulence in the Galleria mellonella insect model.

A larval survival assay and a morbidity and mortality screen were employed to assess the contribution of CapC to virulence. Larval survival levels were used as an indicator of virulence. The proportion of surviving larvae infected with mutant strains was significantly (P < 0.05) increased compared to wild-type strains from 6 to 48 h postinfection (Fig. 3). Mock-infected larvae showed 100% survival rates over 48 h. These results suggest that inactivation of capC causes decreased C. jejuni virulence in the Galleria model.

FIG 3 — Survival of *Galleria mellonella* challenged with *C. jejuni* strains. The larval survival assay was performed with *C. jejuni* 81116, *C. jejuni* M1, and their respective *capC* mutants. Time (in hours) is shown on the x axis. Mock-infected controls treated with PBS were also used. Deletion of *capC* in both *C. jejuni* 81116 and *C. jejuni* M1 causes increased survival of *Galleria* larvae over 48 h. This decrease in survival becomes apparent as early as 4 h postinfection with the onset of larval death which decreases further thereafter. Comparison of mean survival at 24 h postinfection shows that deletion of *capC* causes significantly decreased survival (*C. jejuni* 81116, P < 0.05; *C. jejuni* M1, P < 0.05). These assays were performed in duplicate (10 larvae per replicate) on three different occasions. P values were obtained using an unpaired t test.

The contribution of capC to morbidity and mortality in the Galleria model was also assessed over a period of 24 h postchallenge on the basis of their ability to move, melanization and death using the scoring system outlined in Table S3. C. jejuni 81116 and C. jejuni M1 capC mutant strains exhibited significantly decreased morbidity and mortality in the Galleria model compared to parental strains based on all criteria (Fig. 4A and B). Wild-type strains consistently elicited mortality rates of 90 to 100%, whereas C. jejuni 81116 capC caused 10 to 33% mortality (q value [false-discovery rate] of <0.001) and C. jejuni M1 capC mutant caused 0 to 57% mortality (q value of <0.001). Notably, deletion of capC did not result in a complete cessation in virulence. Galleria mellonella larvae exhibit discoloration upon infection, which is an immune response that results in the deposition of melanin to encapsulate pathogens. capC mutants caused significantly decreased melanization (q value of <0.001), suggesting that CapC is an immunogenic factor that contributes to the inflammatory response in vivo.

FIG 4 — Morbidity and mortality of *Galleria mellonella* infected with *C. jejuni* 81116 (A), *C. jejuni* M1 (B) and their respective *capC* mutants. Twenty-four hours postinfection (p.i.), larvae were assessed for mortality, discoloration, and ability to move and assigned a score based on the scoring system in Table S4 in the supplemental material. Mean virulence scores of biological replicates for each criterion were converted to percentages of the maximum possible score and compared. There were significant differences (q value of <0.001) in the morbidity and mortality elicited by *C. jejuni* 81116 and its *capC* mutant and in the morbidity and mortality elicited by *C. jejuni* M1 and its *capC* mutant as indicated by the asterisks. Morbidity and mortality scores were compared using the multiple t test function in Graphpad Prism v7.03. These assays were performed in triplicate (10 larvae per replicate) on four different occasions; error bars show standard errors of the means.

CapC is required for maximal adhesion to Caco-2 and T84 intestinal epithelial cells.

In order to further investigate the virulence phenotype with which CapC has been correlated, a combination of Caco-2 colorectal epithelial cells and T84 colonic epithelial cell culture models were used. Figure 5A shows adhesion and invasion efficiencies of C. jejuni 81116 and C. jejuni M1 and their respective capC mutants in a partially differentiated Caco-2 cell model, while Fig. 5B shows adhesion and invasion efficiencies of C. jejuni 81116 and C. jejuni M1 and their respective capC mutants in a T84 cell model. Inactivation of capC resulted in significantly reduced adherence and invasion of nonpolarized partially differentiated Caco-2 cells relative to wild-type strains (P = 0.006).

FIG 5 — Adhesion and invasion capability of wild-type *C. jejuni* and *capC* mutant with intestinal epithelial cells. (A) Adhesion and invasion efficiencies of *C. jejuni* 81116, *C. jejuni* M1, and *capC* mutants in a Caco-2 cell culture model infected at an MOI of 1:200. *C. jejuni* 81116 exhibited an adhesion efficiency of 0.174%, whereas the *capC* mutants exhibited an adhesion efficiency of 0.014% (P = 0.0067). Wild-type *C. jejuni* M1 demonstrated a mean adhesion efficiency of 0.173%, whereas the *C. jejuni* M1 *capC* mutant exhibited an adhesion efficiency of 0.0188% (P = 0.033). The wild-type *C. jejuni* 81116 strain exhibited greater invasion efficiency (0.002%) than the mutant strain (0.00039%) (P = 0.048). *C. jejuni* M1 *capC* mutant had a significant impairment in its ability to invade Caco-2 cells compared to the wild-type strain (P = 0.03). These assays were performed in triplicate on three different occasions; error bars show standard errors of the means. (B) Adhesion and invasion efficiencies of *C. jejuni* 81116, *C. jejuni* M1, and *capC* mutants in a nonpolarized T84 cell culture model infected at an MOI of 200. Wild-type *C. jejuni* 81116 and wild-type *C. jejuni* M1 demonstrate adhesion efficiencies of 0.59% and 1.6%, respectively, compared to 0.078% and 0.24% for their *capC* mutants (P > 0.05). *C. jejuni* 81116 invasion efficiency was reduced from 0.019% to 0.002% as a result of *capC* inactivation, and *C. jejuni* M1 invasion efficiency was reduced from 0.039% to 0.014% (P > 0.05). Assays were performed in triplicate on three different occasions; error bars show standard errors of the means. (C) Proportion of associated *C. jejuni* that survive gentamicin treatment in a Caco-2 cell model and a T84 cell culture model. The viable count (in CFU per milliliter) of *C. jejuni* surviving gentamicin treatment is used to calculate invasion efficiency. Values shown are calculated as the number of invaded bacteria divided by the number of associated bacteria and converted to a percentage. The *capC* mutant strains show a slight increase in the proportion of invaded bacteria compared to their coupled wild-type strains, indicating that CapC likely does not cause a proportional decrease in invasion capacity (*C. jejuni* 81116, P > 0.999 by Mann-Whitney test; *C. jejuni* M1, P > 0.999) by Mann-Whitney test. Error bars show standard errors of the means.

The capC mutants also show reduced adhesion and invasion efficiency in a T84 nonpolarized adhesion and invasion model; although this reduction was not statistically significant in the T84 cell culture model (P = 0.06), it was a consistent phenotype observed for both C. jejuni 81116 and C. jejuni M1.

In order to assess whether inactivation of capC affected invasion or indirectly via reduced adherence, the number of C. jejuni surviving gentamicin treatment was represented as a proportion of the number of total associated bacteria (from which the number of adherent bacteria are calculated) and compared (Fig. 5C). The capC mutant strains show a slight increase in the proportion of invaded bacteria compared to their coupled wild-type strains, demonstrating that CapC does not cause a proportional decrease in invasion capacity. Therefore, results from adhesion and invasion assays using Caco-2 and T84 cell lines indicate that CapC directly impacts upon adhesion of C. jejuni 81116 and C. jejuni M1 in vitro, thereby subsequently reducing invasion efficiency.

CapC contributes to IL-8 secretion but does not affect cytotoxicity.

Wild-type C. jejuni and capC mutant strains were compared for cytotoxic activity against Caco-2 cells (Fig. S5). C. jejuni 81116 elicited marginally greater cytotoxicity than its capC mutant counterpart, though this difference was not found to be statistically significant (P = 0.09). The difference in cytotoxicity elicited between C. jejuni M1 and C. jejuni M1 capC mutant was minimal (P = 0.389). These data suggest that CapC does not mediate cytotoxicity and that the levels of cytotoxicity differ markedly between C. jejuni strains.

Interleukin 8 (IL-8) is functionally analogous to insect chemoattractants, such as plasmatocyte spreading peptide (PSP), that promote hemocyte migration and melanin deposition in Galleria larvae and other insects (39). Given that capC gene deficiency caused decreased melanization, presumably through a lack of stimulation of the immune system of Galleria, we aimed to investigate whether capC gene deficiency also caused decreased activation of IL-8. The capC mutants of C. jejuni 81116 and C. jejuni M1 induced a decreased IL-8 response from T84 intestinal epithelial cells compared to respective wild-type strains (Fig. 6). This was more pronounced with C. jejuni M1 compared to C. jejuni 81116. The capC mutant shows a greater reduction in IL-8 secretion (P < 0.05) than the wild-type C. jejuni. These phenotypes are reflective of adhesion and invasion phenotypes observed in the T84 cell model. While the magnitude of the decrease in IL-8 secretion from T84 cells is not consistent in the two capC mutant strains, the observed decrease indicates that CapC may play a role in eliciting immune responses from human intestinal epithelial cells.

FIG 6 — Decrease in IL-8 secretion from T84 cells in response to infection with wild-type *C. jejuni* and *capC* mutant strains (MOI of 1:100). IL-8 secretion is shown in picograms per milliliter. Infection of T84 cells with *capC* mutants caused a decrease in the levels of IL-8 secretion from T84 cells. The greatest decrease was observed in *C. jejuni* M1 *capC* (P = 0.0081). Error bars show standard errors of the means. This assay was performed in quadruplicate on three occasions.

DISCUSSION

During infection, damage to the human gut is mediated by C. jejuni adhesion to, invasion, and translocation across the epithelium (8, 14, 40). Many Campylobacter genes have been proposed to be involved in this interaction, and a variety of mechanisms by which these events occur have been reported (8, 14, 40 –42). These genes include the genes encoding fibronectin binding proteins CadF and FlpA (5, 43), flagellar genes (44), and genes encoding surface structures such as capsule biosynthesis genes, lipooligosaccharide synthesis (LOS) and capsular polysaccharide synthesis (CPS) genes (15, 45). A number of metabolism-related genes have also been reported to be involved in adhesion and invasion, though these may merely be required for survival of C. jejuni during infection (46, 47). Furthermore, the host receptors, kinases, and pathways involved in C. jejuni binding and cell entry are not very well characterized (14). Autotransporters are a class of secretory proteins in Gram-negative bacteria, all of which possess a unifying structure; a single polypeptide composed of an N-terminal signal peptide and passenger domain, which confer targeting to the inner membrane and a virulence function, respectively (18 –20, 29). The C-terminal β-barrel domain, or autotransporter domain, is thought to form a pore in the outer membrane through which the passenger domain is secreted (20). The only autotransporters identified in C. jejuni thus far are CapA, CapB, and an additional autotransporter encoded by the CJ81176_1367 locus in C. jejuni 81-176 (22, 48). CapA is an autotransporter that was previously shown to function as an auxiliary adhesin and may contribute to chicken colonization (22). The role of autotransporters in Gram-negative pathogens is diverse and not limited to adhesion to host cells; these proteins commonly function as serine proteases, esterases, mucinases, toxins, and hemagglutinins (18). In this study, we have characterized a novel autotransporter in C. jejuni, which we have termed CapC. Bioinformatic analysis has revealed that CapC possesses a number of molecular features consistent with previously characterized autotransporter proteins, including the N-terminal signal sequence and the C-terminal barrel domain (30). We have shown that CapC is an outer membrane protein as predicted using bioinformatic tools; this is another feature that is consistent with CapC belonging to the autotransporter family. Given the functions of autotransporters, CapC is a putative virulence determinant in C. jejuni that may contribute to infection processes.

The larvae of the greater wax moth (Galleria mellonella) have been used previously as an effective and powerful model to identify putative virulence determinants in a range of pathogens, including C. jejuni (49 –52). This model has been used to demonstrate that mutants with deletions in factors that have previously been implicated as virulence determinants elicit decreased mortality in the Galleria model, relative to wild-type strains (45, 53). In addition to being an effective and ethical alternative to animal models, the Galleria mellonella virulence model provides a quantifiable measure of virulence within the context of a functional immune system (52, 54, 55).

We have demonstrated that inactivation of capC impairs virulence of C. jejuni in Galleria larvae as determined by the mortality/survival rates and severity of disease (morbidity). However, the mechanism by which CapC contributes to insecticidal activity and therefore virulence in this model is unclear. For example, loss of capsule modification capability conferred by O-methyl phosphoramidate (MeOPN) of Campylobacter has been shown to cause reduced virulence in the Galleria model (45, 56). MeOPN has been shown not to have inherent insecticidal activity however (45), suggesting that reduced virulence is a result of impaired bacterial fitness. Conversely, inactivation of the Dot/Icm type IV secretion system in Legionella pneumophila abolished virulence in Galleria, suggesting that intracellular survival and bacterial proliferation are key to virulence (57). Given that the absence of CapC results in decreased adhesion to human intestinal epithelial cells, it is likely that reduced virulence associated with capC mutants is due to reduced interaction with epithelial cells. Galleria mellonella and other insects, such as Drosophila, exhibit a melanization response upon infection (49). The melanization process is an innate immune response mediated by phenoloxidase (PO) (49, 52, 58). Melanization is triggered by recognition of microbial products, which are often surface exposed, by soluble pattern recognition receptors. This causes a serine protease cascade resulting in cleavage of prophenoloxidase (ProPO) to PO, which in turn, converts phenols to quinines that polymerize to form melanin (48, 50). Melanin is deposited to encapsulate pathogens, resulting in pigmentation of the larvae (49, 58). This process is analogous to abscess formation induced by mammalian infections (49) and can be considered to be part of the inflammatory immune responses of these insects.

In this study, we have demonstrated that the absence of CapC results in a reduced immune response from Galleria, as wild-type strains consistently caused a significantly greater degree of color change in Galleria, indicative of a greater degree of melanization. The absence of CapC also resulted in a reduced inflammatory response from human intestinal cells, as wild-type strains elicited higher IL-8 secretion levels than capC mutants did. IL-8 is a proinflammatory cytokine that plays a key role in mobilizing cellular defense mechanisms. C. jejuni has been demonstrated to stimulate IL-8 secretion from human intestinal cells in vitro via the NF-κB pathway, which is a major downstream target of Toll-like receptor (TLR) signaling pathways (59). Therefore, any change in IL-8 secretion associated with inactivation of capC may be indicative of a change in interaction of C. jejuni with the epithelial cell surface. Furthermore, it has been shown that C. jejuni-induced IL-8 secretion via mitogen-activated protein (MAP) kinase stimulation is dependent upon gene products that are expressed upon contact with epithelial cells (59, 60). The degree of IL-8 secretion in C. jejuni M1 was considerably greater than that elicited by C. jejuni 81116 which correlates with the virulence profiles of these strains in the Galleria model (Fig. 6). Despite causing high levels of morbidity and mortality at 24 h postinfection, the comparatively low IL-8 secretion elicited by wild-type C. jejuni 81116 at 4 h postinfection is likely due to the lower growth rate of this strain (Fig. S4). Previous studies have shown that the flagella, cytolethal distending toxin (CDT), and outer membrane vesicles (OMVs) of Campylobacter have been shown to elicit secretion of IL-8 via activation of TLRs (59). Whether CapC elicits secretion of IL-8 directly or merely inhibits the capacity of other factors to do so is unclear; however, the observed decrease in IL-8 secretion suggests that the absence of CapC affects interactions with epithelial cells.

In addition to fibronectin binding proteins such as CadF and FlpA, factors such as JlpA (61), Peb1a (62), and CapA (22) are reported to influence adhesion to different degrees. This multitude of reported adhesins has complicated understanding of the adhesion process, and is further complicated by the failure to distinguish between factors contributing to bacterial fitness and “true” adhesins involved in direct interaction with the host (62). Furthermore, most of the reported adherence-impaired single gene mutants with mutations in genes encoding the aforementioned factors exhibit only reduced rather than abolished interactions with eukaryotic cells (63). This observation suggests that redundancy of factors may exist in the adhesion process, a compelling notion considering the number of reported factors, and the fact that certain adhesins are not conserved among C. jejuni lineages (22). A combination of nonpolarized, partially differentiated Caco-2 cells and nonpolarized T84 cells were used to demonstrate that CapC contributes to adhesion in these models. Adhesion and invasion efficiencies of capC mutants were decreased in the T84 cell model and significantly decreased in the Caco-2 cell model. Subsequent comparison of the levels of invaded C. jejuni as a proportion of associated bacteria revealed that mutant strains showed marginally increased proportional invasion. Therefore, the observed phenotypes indicate that CapC is required for maximal adhesion to human intestinal cells. Identification of CapC as an additional autotransporter contributing to adhesion suggests that C. jejuni does not have a defined, uniform method of adhesion and invasion of intestinal cells. The results presented here support a case that adhesion, and consequently invasion, are dependent on the cooperative action of several different factors. Moreover, certain adhesins are not conserved between different C. jejuni strains, which indicates that different Campylobacter lineages have different mechanisms of interaction with the host and different strategies of colonization.

Identification of a specific role for CapC in the human niche raises the question as to whether CapC plays a role in the interaction with the chicken host. The outer membrane is the interface for interaction with the host and environment, and many genes involved in interaction with the human host are also implicated in colonization of the chicken (6, 42, 64, 65). For example, CadF and FlpA bind fibronectin in both chicken and human cell models, although they do differ in their expression in each host (5, 14). The CapA autotransporter is involved in adherence to both human intestinal epithelial cells and chicken liver epithelial cells and has been linked to chicken colonization, although it has also shown to be dispensable in certain strains (5, 22). Additionally, a cj0511 serine peptidase mutant that was attenuated in G. mellonella, was shown to have severely reduced capacity for chicken colonization (66).

In this study, we have investigated the contribution of CapC to the virulence of Campylobacter. We have shown that CapC possesses a number of features consistent with autotransporters, including the autotransporter domain which is unique to members of this protein class. Using the Galleria mellonella model, we have shown that capC significantly contributes to virulence in vivo, and likely functions as an adhesin and immunogenic factor. Furthermore, our findings highlight that Campylobacter uses a variety of mechanisms involved in virulence, with many of these being multifactorial and variable between isolates and genetic backgrounds.

MATERIALS AND METHODS

Bacterial strains and culture conditions.

Campylobacter jejuni 81116 (NCTC 11828) and C. jejuni M1 and their respective capC mutant derivatives were routinely cultured on Mueller-Hinton agar (MHA) supplemented with 5% sheep blood or in Mueller-Hinton broth (MHB) and incubated at 42°C in a microaerobic atmosphere generated utilizing Campygen gas packs (Oxoid, UK) (5% O₂, 10% CO₂, and 85% N₂). Cultures were supplemented with trimethoprim (100 μg ml⁻¹), chloramphenicol (10 μg ml⁻¹), and/or kanamycin (50 μg ml⁻¹) where appropriate. Escherichia coli DH5α and E. coli JM109 were used for propagation of plasmids, and constructs were maintained in Luria-Bertani broth supplemented with 25% glycerol at −80°C in 1.5-ml vials. E. coli strains were cultivated in an aerobic environment at 37°C for 16 to 24 h.

Bioinformatic tools and sequence analysis.

The nucleotide sequence and predicted protein sequence encoded by capC were downloaded in Fasta format from the CampyDB database resource at http://xbase.warwick.ac.uk/campydb/. CapC is annotated as C8J_1278 in C. jejuni 81116 and CJM1_1321 in C. jejuni M1. These sequences were used for all bioinformatic analyses. The NCBI Conserved Domain Database (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) is a publically available tool that can be used to annotate conserved domains in protein sequences. This tool was used to identify potential conserved domains in capC. The SignalP 4.1 server (http://www.cbs.dtu.dk/services/SignalP/) was used to predict putative signal peptides within CapC. The subcellular localization prediction tools Cello V2.5 (http://cello.life.nctu.edu.tw/) and PSORTb (http://www.psort.org/psortb/index.html) were used to predict the localization site of CapC. Phyre2 (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index) was used to build a partial three-dimensional (3D) model of the CapC protein structure based on remote homology detection methods.

Generation of capC-deficient mutants.

The capC gene in C. jejuni strains 81116 and M1 was inactivated using a chloramphenicol resistance cassette insert. The capC gene was amplified from C. jejuni strains 81116 and M1 using the CapCFW (FW stands for forward) and CapCRV (RV stands for reverse) primers (Table 1), resulting in a 2,893-bp fragment. This fragment was cloned into pGEM-T Easy, and the resulting pJM005 was digested with BglII and XbaI, cleaving the capC sequence after nucleotide positions 1501 and 2164, respectively, and thus excising a 647-bp capC fragment from the plasmid. The chloramphenicol resistance (cat) cassette was amplified from pAV103 using the primers JMCAT5 and JMCAT6 (67), digested with BglII and XbaI, and ligated into pJM005, thereby creating pJM007. A 1,906-bp fragment amplified from pJM007 using the Vac1 and Cap3 primers was used to transform C. jejuni 81116 and M1 by electroporation by the method of Holt et al. (68). Table 1 and Table S2 in the supplemental material detail all oligonucleotide primers and plasmids used in this study, respectively.

TABLE 1.

Oligonucleotide primers used in this study

Primer name^a	Primer sequence (5′–3′)^b	Restriction site^c	Reference
Cap1	CAATTAGGAAGTATAGGCGCA	N/A	This study
Cap2	AGCACCCACTTCAACACTTAC	N/A	This study
Vac1	GTGTAATCATCACCACTATTGATA	N/A	This study
JMCAT5	AAAAGATCTCTCGGCGGTGTTCCTTTCCAAG	BglII	This study
JMCAT6	GATTCTAGACGCCCTTTAGTTCCTAAAGGGT	XbaI	This study
CC069	ATATGTGCAGGGCGTATTGC	N/A	37
Cj0046F	CACTACCCAATTGAAAATCTAAG	N/A	72
Cj0046R	GTGAGTTAATGCCATCATAAC	N/A	72
Cap3	CCAAATGGATTATCAAGGC	N/A	This study
Cap4	GCTTGTTTATCTACTCCCACGG	N/A	This study
CapC-Fw	ACTTGGCTTCGACAGGAGT	N/A	This study
CapC-Rv	AAGATAAAGCCCTAGGAGATTTC	N/A	This study
BamCapC-FW	GATGGATCCTGAAGGAGAAACTTATGAAG	BamHI	This study
BamCapC-RV	GATGGATCCAAGATAAAGCCCTAGGAGATTTC	BamHI	This study
pSV009FW1	TAATAGAAATTTCCCCAAGTCCCA	N/A	37
pSV009RV1	CTATTGCCATAGTAGCTCTTAGTGG	N/A	37
CapCFBam	GATGGATCCACTTGGCTTCGACAGGAGT	BamHI	This study
CapCRXho	GATCTCGAGAAGATAAAGCCCTAGGAGATTTC	XhoI	This study

Open in a new tab

Forward primers are indicated by F, Fw, or FW at the end or in the middle of the primer designation, and reverse primers are indicated by R, Rv, or RV at the end or in the middle of the primer designation.

The restriction sites are shown underlined.

N/A, not applicable.

Isolation of cellular fractions.

C. jejuni was harvested from agar plates and diluted in 10 mM HEPES (Sigma, UK) to an optical density at 600 nm (OD₆₀₀) of 0.8 (approximately 5 × 10⁷ CFU/ml). These bacterial suspensions were used to isolate supernatant, outer membrane, inner membrane, and cytoplasmic fractions by the method of Sommerlad and Hendrixson (69).

Antiserum generation and immunoblot analysis.

Rabbit polyclonal antibodies specific to CapC were generated using a synthetic peptide (EKLQQEAMQNGGKIDDEKY) designed with the Antigen Profiler software provided by Life Technologies (Thermo Fisher). New Zealand White rabbits were immunized over a period of 70 days and bled three times to obtain crude antibody sera. Immunoblotting was performed as described previously with minor modifications (69).

Membrane fractions were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis using 12.5% Novex Tris-glycine precast protein gels (Thermo Scientific, UK), and proteins were subsequently transferred to polyvinylidene difluoride (PVDF) membranes (Fisher, UK) using a Pierce Power Blot cassette (Thermo Scientific, UK) using Pierce one-step transfer buffer (Thermo Scientific, UK). PVDF membranes were probed with primary anti-CapC antibody diluted 1:1,000 in 10 ml Tris-buffered saline with Tween 20 (TBST) and 3% milk powder for 1 h at room temperature. The membranes were washed and probed with goat anti-rabbit secondary antibody conjugated to horseradish peroxidase (catalog no. ab6721; Abcam) diluted 1:5,000. Exposure and image capture were performed using a Licor Odyssey Fc imager.

Galleria mellonella virulence model.

Galleria mellonella larvae were purchased from commercial suppliers Livefood or Livefoods Direct. Use of this model provides the basis for a rapid screening of virulence phenotypes within the context of a functional immune system comparable to that of mammals. Factors implicated as integral to Campylobacter infection of the human host have also been shown to contribute to insecticidal activity in this model (51, 66, 70). Larvae were shipped at the fifth- or sixth-instar stage (approximately 2 to 3 cm in length) and were suitable for use immediately. Larvae were maintained at 17°C on wood chips for up to 2 weeks. All larvae were handled using ethanol-sterilized blunt-nosed forceps and examined prior to infection; any larvae showing discoloration or signs of pupation were immediately discarded and euthanized. Healthy larvae were selected on the basis of their uniform creamy color with no areas of dark discoloration and that they were able to right themselves quickly if turned over. C. jejuni strains were grown overnight and resuspended in phosphate-buffered saline (PBS) to an OD₅₉₀ of 1 (1 × 10⁸ CFU/ml). This bacterial suspension was used to infect Galleria larvae. Larvae were injected into the top right proleg with 10 μl bacterial cell suspension. Injection was performed using a Hamilton 26S Microliter syringe (Sigma). Once infected, larvae were placed on a Whatman 90-mm filter paper in an inverted petri dish and incubated at 37°C for up to 48 h. A negative control in which larvae were injected with PBS only and a noninfected control were also included. Ten larvae were infected for each isolate in triplicate on four separate occasions. Mortality was confirmed by the inability of larvae to respond to physical stimuli (56).

Cell lines, media, and culture conditions.

Caco-2 cells were maintained in Dulbecco's modified Eagle medium (DMEM) (Gibco) supplemented with 10% fetal bovine serum (FBS), 1% nonessential amino acids and 1% (wt/vol) 100 U ml⁻¹ penicillin and 100 μg ml⁻¹ streptomycin. T84 cells were maintained in DMEM/F-12 Ham's nutrient mix (Invitrogen) supplemented with 10% (vol/vol) fetal calf serum (FCS), 1% (wt/vol) nonessential amino acids, and 100 U ml⁻¹ penicillin and 100 μg ml⁻¹ streptomycin. For certain assays, the medium from Caco-2 or T84 cells was removed, and the monolayers were washed twice with PBS and then maintained in antibiotic-free and/or serum-free DMEM/F-12 Ham's nutrient mix.

Adhesion and invasion assays.

CFU-based adherence assay and gentamicin protection assays were conducted as described previously with minor modifications (70, 71). Caco-2 cells were seeded for 1 week in 24-well plates at 1 × 10⁶ cells ml⁻¹ in 1 ml of DMEM in 24-well plates and infected with 100 μl of C. jejuni suspensions prepared as described above at a multiplicity of infection (MOI) of 1:200. The cells were incubated at 37°C for 3.5 h in a 5% CO₂ humidified incubator. Monolayers were lysed with prewarmed 1% (wt/vol) Triton X-100 to release cell-associated bacteria which were enumerated. A gentamicin protection assay was performed in conjunction with the adhesion assay. After incubation for 3.5 h, the medium was removed, monolayers were washed, and complete DMEM supplemented with gentamicin to a final concentration of 150 μg ml⁻¹ was added to each well. The plates were reincubated for 2 h at 37°C followed by bacterial enumeration.

Adhesion and invasion efficiencies were calculated as described previously (71). Additionally, the number of invaded bacteria as a proportion of associated bacteria (the number counted in adherence assays) was calculated.

Cytotoxicity assay.

Cytotoxicity assays were performed using the Pierce lactate dehydrogenase (LDH) cytotoxicity assay kit according to the manufacturers' instructions (Thermo Fisher, UK). Caco-2 cells were seeded at 1 × 10⁵ per well of a 96-well plate in 100 μl of complete DMEM for 48 h. Cultures of wild-type C. jejuni and capC mutants grown in broth for 24 h were resuspended in PBS to an OD₅₉₀ of 1.0, with 10 μl of this suspension being used to inoculate the appropriate wells in triplicate. Serum-free DMEM and complete DMEM without cells were included to account for LDH activity in sera. The plates were incubated for 4 h at 37°C in a 5% CO₂ humidified incubator. Absorbance was measured at 490 nm and 680 nm using a Wallac plate reader, and the percentage of cytotoxicity was calculated. These assays were performed in quintuplet on three different occasions.

ELISA for IL-8.

The levels of IL-8 secretion from T84 cells were assessed using the eBioscience IL-8 enzyme-linked immunosorbent assay (ELISA) kit according to the manufacturer's instructions. T84 cells were infected with C. jejuni as described above. After 4-h incubation, the infected-cell supernatant was removed and added to the wells of a 96-well Nunc Maxisorp plate, in quadruplicate, which had been preblocked and exposed to a capture antibody specific for IL-8. The plates were incubated overnight, and the levels of IL-8 secretion were determined according to the manufacturer's instructions. OD was measured on a Wallac plate reader at 450 nm, and the levels of IL-8 secretion were determined. This assay was repeated three times.

Statistical analysis.

All statistical analyses were performed with Graphpad Prism (v 7.0; Graphpad Software). Data from wild-type and capC mutants were compared using a Mann-Whitney test or an unpaired t test. Differences were considered significant at a P of <0.05. Virulence in the Galleria mellonella model was compared using multiple t test function in Graphpad Prism v 7.0 (false-discovery rate of 0.1) to obtain adjusted P values (q values).

Supplementary Material

Supplemental material

supp_84_16_e01032-18__index.html^{(1KB, html)}

ACKNOWLEDGMENT

Anti-MOMP antibodies were a kind gift from Qijing Zhang.

Footnotes

Supplemental material for this article may be found at https://doi.org/10.1128/AEM.01032-18.

REFERENCES

1.Butzler J-P. 2004. Campylobacter, from obscurity to celebrity. Clin Microbiol Infect 10:868–876. doi: 10.1111/j.1469-0691.2004.00983.x. [DOI] [PubMed] [Google Scholar]
2.Kaakoush NO, Castaño-Rodríguez N, Mitchell HM, Man SM. 2015. Global epidemiology of Campylobacter infection. Clin Microbiol Rev 28:687–720. doi: 10.1128/CMR.00006-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Tam CC, O'Brien SJ, Tompkins DS, Bolton FJ, Berry L, Dodds J, Choudhury D, Halstead F, Iturriza-Gó M, Mather K, Rait G, Ridge A, Rodrigues LC, Wain J, Wood B, Gray JJ, IID2 Study Executive Committee. 2012. Changes in causes of acute gastroenteritis in the United Kingdom over 15 years: microbiologic findings from 2 prospective, population-based studies of infectious intestinal disease. Clin Infect Dis 54:1275–1286. doi: 10.1093/cid/cis028. [DOI] [PubMed] [Google Scholar]
4.Tam CC, O'Brien SJ. 2016. Economic cost of Campylobacter, norovirus and rotavirus disease in the United Kingdom. PLoS One 11:e0138526. doi: 10.1371/journal.pone.0138526. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Flanagan RC, Neal-McKinney JM, Dhillon AS, Miller WG, Konkel ME. 2009. Examination of Campylobacter jejuni putative adhesins leads to the identification of a new protein, designated FlpA, required for chicken colonization. Infect Immun 77:2399–2407. doi: 10.1128/IAI.01266-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Hermans D, Van Deun K, Martel A, Van Immerseel F, Messens W, Heyndrickx M, Haesebrouck F, Pasmans F. 2011. Colonization factors of Campylobacter jejuni in the chicken gut. Vet Res 42:82. doi: 10.1186/1297-9716-42-82. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Ziprin RL, Young CR, Byrd JA, Stanker LH, Hume ME, Gray SA, Kim BJ, Konkel ME. 2001. Role of Campylobacter jejuni potential virulence genes in cecal colonization. Avian Dis 45:549–557. doi: 10.2307/1592894. [DOI] [PubMed] [Google Scholar]
8.Young KT, Davis LM, DiRita VJ. 2007. Campylobacter jejuni: molecular biology and pathogenesis. Nat Rev Microbiol 5:665–679. doi: 10.1038/nrmicro1718. [DOI] [PubMed] [Google Scholar]
9.Black RE, Levine MM, Clements ML, Hughes TP, Blaser MJ. 1988. Experimental Campylobacter jejuni infection in humans. J Infect Dis 157:472–479. doi: 10.1093/infdis/157.3.472. [DOI] [PubMed] [Google Scholar]
10.Newell DG. 2002. The ecology of Campylobacter jejuni in avian and human hosts and in the environment. Int J Infect Dis 6:S16–S21. doi: 10.1016/S1201-9712(02)90179-7. [DOI] [PubMed] [Google Scholar]
11.Everest PH, Goossens H, Butzler JP, Lloyd D, Knutton S, Ketley JM, Williams PH. 1992. Differentiated Caco-2 cells as a model for enteric invasion by Campylobacter jejuni and C. coli. J Med Microbiol 37:319–325. doi: 10.1099/00222615-37-5-319. [DOI] [PubMed] [Google Scholar]
12.Baig A, McNally A, Dunn S, Paszkiewicz KH, Corander J, Manning G. 2015. Genetic import and phenotype specific alleles associated with hyper-invasion in Campylobacter jejuni. BMC Genomics 16:852. doi: 10.1186/s12864-015-2087-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Humphrey S, Lacharme-Lora L, Chaloner G, Gibbs K, Humphrey T, Williams N, Wigley P. 2015. Heterogeneity in the infection biology of Campylobacter jejuni isolates in three infection models reveals an invasive and virulent phenotype in a ST21 isolate from poultry. PLoS One 10:e0141182. doi: 10.1371/journal.pone.0141182. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.O Cróinín T, Backert S. 2012. Host epithelial cell invasion by Campylobacter jejuni: trigger or zipper mechanism? Front Cell Infect Microbiol 2:25. doi: 10.3389/fcimb.2012.00025. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Backert S, Boehm M, Wessler S, Tegtmeyer N. 2013. Transmigration route of Campylobacter jejuni across polarized intestinal epithelial cells: paracellular, transcellular or both? Cell Commun Signal 11:72. doi: 10.1186/1478-811X-11-72. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Chaloner G, Wigley P, Humphrey S, Kemmett K, Lacharme-Lora L, Humphrey T, Williams N. 2014. Dynamics of dual infection with Campylobacter jejuni strains in chickens reveals distinct strain-to-strain variation in infection ecology. Appl Environ Microbiol 80:6366–6372. doi: 10.1128/AEM.01901-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Baig A, Manning G. 2014. Campylobacter association with the human host, p 99–110. In Sheppard SK. (ed), Campylobacter ecology and evolution. Caister Academic Press, Poole, United Kingdom. [Google Scholar]
18.Nishimura K, Tajima N, Yoon Y-H, Park S-Y, Tame JRH. 2010. Autotransporter passenger proteins: virulence factors with common structural themes. J Mol Med 88:451–458. doi: 10.1007/s00109-010-0600-y. [DOI] [PubMed] [Google Scholar]
19.Henderson IR, Navarro-Garcia F, Nataro JP. 1998. The great escape: structure and function of the autotransporter proteins. Trends Microbiol 6:370–378. doi: 10.1016/S0966-842X(98)01318-3. [DOI] [PubMed] [Google Scholar]
20.Leo JC, Grin I, Linke D. 2012. Type V secretion: mechanism(s) of autotransport through the bacterial outer membrane. Philos Trans R Soc Lond B Biol Sci 367:1088–1101. doi: 10.1098/rstb.2011.0208. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Diavatopoulos D, Hijnen M, Mooi F. 2006. Adaptive evolution of the Bordetella autotransporter pertactin. J Evol Biol 19:1931–1938. doi: 10.1111/j.1420-9101.2006.01154.x. [DOI] [PubMed] [Google Scholar]
22.Ashgar SSA, Oldfield NJ, Wooldridge KG, Jones MA, Irving GJ, Turner DPJ, Ala'Aldeen DAA. 2007. CapA, an autotransporter protein of Campylobacter jejuni, mediates association with human epithelial cells and colonization of the chicken gut. J Bacteriol 189:1856–1865. doi: 10.1128/JB.01427-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Friis C, Wassenaar TM, Javed MA, Snipen L, Lagesen K, Hallin PF, Newell DG, Toszeghy M, Ridley A, Manning G, Ussery DW. 2010. Genomic characterization of Campylobacter jejuni strain M1. PLoS One 5:e12253. doi: 10.1371/journal.pone.0012253. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Gundogdu O, Bentley SD, Holden MT, Parkhill J, Dorrell N, Wren BW. 2007. Re-annotation and re-analysis of the Campylobacter jejuni NCTC11168 genome sequence. BMC Genomics 8:162. doi: 10.1186/1471-2164-8-162. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Pearson BM, Gaskin DJH, Segers RPAM, Wells JM, Nuijten PJM, van Vliet AHM. 2007. The complete genome sequence of Campylobacter jejuni strain 81116 (NCTC11828). J Bacteriol 189:8402–8403. doi: 10.1128/JB.01404-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Richardson PT, Park SF. 1998. Molecular characterization of a strain-specific sequence in Campylobacter jejuni. Lett Appl Microbiol 26:113–117. doi: 10.1046/j.1472-765X.1998.00290.x. [DOI] [PubMed] [Google Scholar]
27.Drobnak I, Braselmann E, Clark PL. 2015. Multiple driving forces required for efficient secretion of autotransporter virulence proteins. J Biol Chem 290:10104–10116. doi: 10.1074/jbc.M114.629170. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Wells TJ, Tree JJ, Ulett GC, Schembri MA. 2007. Autotransporter proteins: novel targets at the bacterial cell surface. FEMS Microbiol Lett 274:163–172. doi: 10.1111/j.1574-6968.2007.00833.x. [DOI] [PubMed] [Google Scholar]
29.Henderson IR, Navarro-Garcia F, Desvaux M, Fernandez RC, Ala'Aldeen D. 2004. Type V protein secretion pathway: the autotransporter story. Microbiol Mol Biol Rev 68:692–744. doi: 10.1128/MMBR.68.4.692-744.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Oomen CJ, van Ulsen P, van Gelder P, Feijen M, Tommassen J, Gros P. 2004. Structure of the translocator domain of a bacterial autotransporter. EMBO J 23:1257–1266. doi: 10.1038/sj.emboj.7600148. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Petersen TN, Brunak S, von Heijne G, Nielsen H. 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods 8:785–786. doi: 10.1038/nmeth.1701. [DOI] [PubMed] [Google Scholar]
32.Horton P, Park K-J, Obayashi T, Fujita N, Harada H, Adams-Collier CJ, Nakai K. 2007. WoLF PSORT: protein localization predictor. Nucleic Acids Res 35(Web Server issue):W585–W587. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Yu C-S, Cheng C-W, Su W-C, Chang K-C, Huang S-W, Hwang J-K, Lu C-H. 2014. CELLO2GO: a web server for protein subCELlular LOcalization prediction with functional gene ontology annotation. PLoS One 9:e99368. doi: 10.1371/journal.pone.0099368. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Kelley LA, Mezulis S, Yates CM, Wass MN, Sternberg MJE. 2015. The Phyre2 web portal for protein modeling, prediction and analysis. Nat Protoc 10:845–858. doi: 10.1038/nprot.2015.053. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Zhang Q, Meitzler JC, Huang S, Morishita T. 2000. Sequence polymorphism, predicted secondary structures, and surface-exposed conformational epitopes of Campylobacter major outer membrane protein. Infect Immun 68:5679–5689. doi: 10.1128/IAI.68.10.5679-5689.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Gaskin DJH, Van Vliet AHM, Pearson BM. 2007. The Campylobacter genetic toolbox: development of tractable and generally applicable genetic techniques for Campylobacter jejuni. Zoonotic Public Health 54:101. [Google Scholar]
37.de Vries SPW, Gupta S, Baig A, L'Heureux J, Pont E, Wolanska DP, Maskell DJ, Grant AJ. 2015. Motility defects in Campylobacter jejuni defined gene deletion mutants caused by second-site mutations. Microbiology (Reading) 161:2316–2327. doi: 10.1099/mic.0.000184. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.de Vries SP, Gupta S, Baig A, Wright E, Wedley A, Jensen AN, Lora LL, Humphrey S, Skovgård H, Macleod K, Pont E, Wolanska DP, L'Heureux J, Mobegi FM, Smith DGE, Everest P, Zomer A, Williams N, Wigley P, Humphrey T, Maskell DJ, Grant AJ. 2017. Genome-wide fitness analyses of the foodborne pathogen Campylobacter jejuni in in vitro and in vivo models. Sci Rep 7:1251. doi: 10.1038/s41598-017-01133-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.González-Santoyo I, Córdoba-Aguilar A. 2012. Phenoloxidase: a key component of the insect immune system. Entomol Exp Appl 142:1–16. doi: 10.1111/j.1570-7458.2011.01187.x. [DOI] [Google Scholar]
40.Bouwman LI, Niewold P, van Putten JPM. 2013. Basolateral invasion and trafficking of Campylobacter jejuni in polarized epithelial cells. PLoS One 8:e54759. doi: 10.1371/journal.pone.0054759. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Krause-Gruszczynska M, Boehm M, Rohde M, Tegtmeyer N, Takahashi S, Buday L, Oyarzabal OA, Backert S. 2011. The signaling pathway of Campylobacter jejuni-induced Cdc42 activation: role of fibronectin, integrin beta1, tyrosine kinases and guanine exchange factor Vav2. Cell Commun Signal 9:32. doi: 10.1186/1478-811X-9-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Hofreuter D. 2014. Defining the metabolic requirements for the growth and colonization capacity of Campylobacter jejuni. Front Cell Infect Microbiol 4:137. doi: 10.3389/fcimb.2014.00137. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Konkel ME, Larson CL, Flanagan RC. 2010. Campylobacter jejuni FlpA binds fibronectin and is required for maximal host cell adherence. J Bacteriol 192:68–76. doi: 10.1128/JB.00969-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Eucker TP, Konkel ME. 2012. The cooperative action of bacterial fibronectin-binding proteins and secreted proteins promote maximal Campylobacter jejuni invasion of host cells by stimulating membrane ruffling. Cell Microbiol 14:226–238. doi: 10.1111/j.1462-5822.2011.01714.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.van Alphen LB, Wenzel CQ, Richards MR, Fodor C, Ashmus RA, Stahl M, Karlyshev AV, Wren BW, Stintzi A, Miller WG, Lowary TL, Szymanski CM. 2014. Biological roles of the O-methyl phosphoramidate capsule modification in Campylobacter jejuni. PLoS One 9:e87051. doi: 10.1371/journal.pone.0087051. [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Pei Z, Burucoa C, Grignon B, Baqar S, Huang XZ, Kopecko DJ, Bourgeois AL, Fauchere JL, Blaser MJ. 1998. Mutation in the peb1A locus of Campylobacter jejuni reduces interactions with epithelial cells and intestinal colonization of mice. Infect Immun 66:938–943. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Hofreuter D, Mohr J, Wensel O, Rademacher S, Schreiber K, Schomburg D, Gao B, Galán JE. 2012. Contribution of amino acid catabolism to the tissue specific persistence of Campylobacter jejuni in a murine colonization model. PLoS One 7:e50699. doi: 10.1371/journal.pone.0050699. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Watson E, Sherry A, Inglis NF, Lainson A, Jyothi D, Yaga R, Manson E, Imrie L, Everest P, Smith DGE. 2014. Proteomic and genomic analysis reveals novel Campylobacter jejuni outer membrane proteins and potential heterogeneity. EuPA Open Proteom 4:184–194. doi: 10.1016/j.euprot.2014.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Tsai CJ-Y, Loh JMS, Proft T. 2016. Galleria mellonella infection models for the study of bacterial diseases and for antimicrobial drug testing. Virulence 7:214–229. doi: 10.1080/21505594.2015.1135289. [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Eisenman HC, Duong R, Chan H, Tsue R, McClelland EE. 2014. Reduced virulence of melanized Cryptococcus neoformans in Galleria mellonella. Virulence 5:611–618. doi: 10.4161/viru.29234. [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Senior NJ, Bagnall MC, Champion OL, Reynolds SE, La Ragione RM, Woodward MJ, Salguero FJ, Titball RW. 2011. Galleria mellonella as an infection model for Campylobacter jejuni virulence. J Med Microbiol 60:661–669. doi: 10.1099/jmm.0.026658-0. [DOI] [PubMed] [Google Scholar]
52.Joyce SA, Gahan CGM. 2010. Molecular pathogenesis of Listeria monocytogenes in the alternative model host Galleria mellonella. Microbiology (Reading) 156:3456–3468. doi: 10.1099/mic.0.040782-0. [DOI] [PubMed] [Google Scholar]
53.Askoura M, Sarvan S, Couture J-F, Stintzi A. 2016. The Campylobacter jejuni ferric uptake regulator promotes acid survival and cross-protection against oxidative stress. Infect Immun 84:1287–1300. doi: 10.1128/IAI.01377-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Salem HM, Hussein MA, Hafez SE, Hussein MA, Sayed RM. 2014. Ultrastructure changes in the haemocytes of Galleria mellonella larvae treated with gamma irradiated Steinernema carpocapsae BA2. J Radiat Res Appl Sci 7:74–79. doi: 10.1016/j.jrras.2013.12.005. [DOI] [Google Scholar]
55.Chain BM, Anderson RS. 1983. Inflammation in insects: the release of a plasmatocyte depletion factor following interaction between bacteria and haemocytes. J Insect Physiol 29:1–4. doi: 10.1016/0022-1910(83)90099-9. [DOI] [Google Scholar]
56.Champion OL, Karlyshev AV, Senior NJ, Woodward M, La Ragione R, Howard SL, Wren BW, Titball RW. 2010. Insect infection model for Campylobacter jejuni reveals that O-methyl phosphoramidate has insecticidal activity. J Infect Dis 201:776–782. [DOI] [PubMed] [Google Scholar]
57.Harding CR, Schroeder GN, Collins JW, Frankel G. 2013. Use of Galleria mellonella as a model organism to study Legionella pneumophila infection. J Vis Exp 2013:e50964. doi: 10.3791/50964. [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Lu A, Zhang Q, Zhang J, Yang B, Wu K, Xie W, Luan Y-X, Ling E. 2014. Insect prophenoloxidase: the view beyond immunity. Front Physiol 5:252. doi: 10.3389/fphys.2014.00252. [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Zheng J, Meng J, Zhao S, Singh R, Song W. 2008. Campylobacter-induced interleukin-8 secretion in polarized human intestinal epithelial cells requires Campylobacter-secreted cytolethal distending toxin- and Toll-like receptor-mediated activation of NF-kappaB. Infect Immun 76:4498–4508. doi: 10.1128/IAI.01317-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Watson RO, Galán JE. 2005. Signal transduction in Campylobacter jejuni-induced cytokine production. Cell Microbiol 7:655–665. doi: 10.1111/j.1462-5822.2004.00498.x. [DOI] [PubMed] [Google Scholar]
61.Jin S, Joe A, Lynett J, Hani EK, Sherman P, Chan VL. 2001. JlpA, a novel surface-exposed lipoprotein specific to Campylobacter jejuni, mediates adherence to host epithelial cells. Mol Microbiol 39:1225–1236. doi: 10.1111/j.1365-2958.2001.02294.x. [DOI] [PubMed] [Google Scholar]
62.Pei Z, Blaser MJ. 1993. PEB1, the major cell-binding factor of Campylobacter jejuni, is a homolog of the binding component in gram-negative nutrient transport systems. J Biol Chem 268:18717–18725. [PubMed] [Google Scholar]
63.van Alphen LB, Bleumink-Pluym NMC, Rochat KD, van Balkom BWM, Wösten MMSM, van Putten JPM. 2008. Active migration into the subcellular space precedes Campylobacter jejuni invasion of epithelial cells. Cell Microbiol 10:53–66. [DOI] [PubMed] [Google Scholar]
64.Pielsticker C, Glünder G, Rautenschlein S. 2012. Colonization properties of Campylobacter jejuni in chickens. Eur J Microbiol Immunol 2:61–65. doi: 10.1556/EuJMI.2.2012.1.9. [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Hendrixson DR, DiRita VJ. 2004. Identification of Campylobacter jejuni genes involved in commensal colonization of the chick gastrointestinal tract. Mol Microbiol 52:471–484. doi: 10.1111/j.1365-2958.2004.03988.x. [DOI] [PubMed] [Google Scholar]
66.Karlyshev AV, Thacker G, Jones MA, Clements MO, Wren BW. 2014. Campylobacter jejuni gene cj0511 encodes a serine peptidase essential for colonisation. FEBS Open Bio 4:468–472. doi: 10.1016/j.fob.2014.04.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Baillon ML, van Vliet AH, Ketley JM, Constantinidou C, Penn CW. 1999. An iron-regulated alkyl hydroperoxide reductase (AhpC) confers aerotolerance and oxidative stress resistance to the microaerophilic pathogen Campylobacter jejuni. J Bacteriol 181:4798–4804. [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Holt JP, Grant AJ, Coward C, Maskell DJ, Quinlan JJ. 2012. Identification of Cj1051c as a major determinant for the restriction barrier of Campylobacter jejuni strain NCTC11168. Appl Environ Microbiol 78:7841–7848. doi: 10.1128/AEM.01799-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
69.Sommerlad SM, Hendrixson DR. 2007. Analysis of the roles of FlgP and FlgQ in flagellar motility of Campylobacter jejuni. J Bacteriol 189:179–186. doi: 10.1128/JB.01199-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Elmi A, Watson E, Sandu P, Gundogdu O, Mills DC, Inglis NF, Manson E, Imrie L, Bajaj-Elliott M, Wren BW, Smith DGE, Dorrell N. 2012. Campylobacter jejuni outer membrane vesicles play an important role in bacterial interactions with human intestinal epithelial cells. Infect Immun 80:4089–4098. doi: 10.1128/IAI.00161-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
71.Javed MA, Cawthraw SA, Baig A, Li J, McNally A, Oldfield NJ, Newell DG, Manning G. 2012. Cj1136 is required for lipooligosaccharide biosynthesis, hyperinvasion, and chick colonization by Campylobacter jejuni. Infect Immun 80:2361–2370. doi: 10.1128/IAI.00151-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Reuter M, van Vliet AHM. 2013. Signal balancing by the CetABC and CetZ chemoreceptors controls energy taxis in Campylobacter jejuni. PLoS One 8:e54390. doi: 10.1371/journal.pone.0054390. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

supp_84_16_e01032-18__index.html^{(1KB, html)}

AEM.01032-18_zam016188685s1.pdf^{(459.6KB, pdf)}

[B1] 1.Butzler J-P. 2004. Campylobacter, from obscurity to celebrity. Clin Microbiol Infect 10:868–876. doi: 10.1111/j.1469-0691.2004.00983.x. [DOI] [PubMed] [Google Scholar]

[B2] 2.Kaakoush NO, Castaño-Rodríguez N, Mitchell HM, Man SM. 2015. Global epidemiology of Campylobacter infection. Clin Microbiol Rev 28:687–720. doi: 10.1128/CMR.00006-15. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B3] 3.Tam CC, O'Brien SJ, Tompkins DS, Bolton FJ, Berry L, Dodds J, Choudhury D, Halstead F, Iturriza-Gó M, Mather K, Rait G, Ridge A, Rodrigues LC, Wain J, Wood B, Gray JJ, IID2 Study Executive Committee. 2012. Changes in causes of acute gastroenteritis in the United Kingdom over 15 years: microbiologic findings from 2 prospective, population-based studies of infectious intestinal disease. Clin Infect Dis 54:1275–1286. doi: 10.1093/cid/cis028. [DOI] [PubMed] [Google Scholar]

[B4] 4.Tam CC, O'Brien SJ. 2016. Economic cost of Campylobacter, norovirus and rotavirus disease in the United Kingdom. PLoS One 11:e0138526. doi: 10.1371/journal.pone.0138526. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B5] 5.Flanagan RC, Neal-McKinney JM, Dhillon AS, Miller WG, Konkel ME. 2009. Examination of Campylobacter jejuni putative adhesins leads to the identification of a new protein, designated FlpA, required for chicken colonization. Infect Immun 77:2399–2407. doi: 10.1128/IAI.01266-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B6] 6.Hermans D, Van Deun K, Martel A, Van Immerseel F, Messens W, Heyndrickx M, Haesebrouck F, Pasmans F. 2011. Colonization factors of Campylobacter jejuni in the chicken gut. Vet Res 42:82. doi: 10.1186/1297-9716-42-82. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B7] 7.Ziprin RL, Young CR, Byrd JA, Stanker LH, Hume ME, Gray SA, Kim BJ, Konkel ME. 2001. Role of Campylobacter jejuni potential virulence genes in cecal colonization. Avian Dis 45:549–557. doi: 10.2307/1592894. [DOI] [PubMed] [Google Scholar]

[B8] 8.Young KT, Davis LM, DiRita VJ. 2007. Campylobacter jejuni: molecular biology and pathogenesis. Nat Rev Microbiol 5:665–679. doi: 10.1038/nrmicro1718. [DOI] [PubMed] [Google Scholar]

[B9] 9.Black RE, Levine MM, Clements ML, Hughes TP, Blaser MJ. 1988. Experimental Campylobacter jejuni infection in humans. J Infect Dis 157:472–479. doi: 10.1093/infdis/157.3.472. [DOI] [PubMed] [Google Scholar]

[B10] 10.Newell DG. 2002. The ecology of Campylobacter jejuni in avian and human hosts and in the environment. Int J Infect Dis 6:S16–S21. doi: 10.1016/S1201-9712(02)90179-7. [DOI] [PubMed] [Google Scholar]

[B11] 11.Everest PH, Goossens H, Butzler JP, Lloyd D, Knutton S, Ketley JM, Williams PH. 1992. Differentiated Caco-2 cells as a model for enteric invasion by Campylobacter jejuni and C. coli. J Med Microbiol 37:319–325. doi: 10.1099/00222615-37-5-319. [DOI] [PubMed] [Google Scholar]

[B12] 12.Baig A, McNally A, Dunn S, Paszkiewicz KH, Corander J, Manning G. 2015. Genetic import and phenotype specific alleles associated with hyper-invasion in Campylobacter jejuni. BMC Genomics 16:852. doi: 10.1186/s12864-015-2087-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13.Humphrey S, Lacharme-Lora L, Chaloner G, Gibbs K, Humphrey T, Williams N, Wigley P. 2015. Heterogeneity in the infection biology of Campylobacter jejuni isolates in three infection models reveals an invasive and virulent phenotype in a ST21 isolate from poultry. PLoS One 10:e0141182. doi: 10.1371/journal.pone.0141182. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14.O Cróinín T, Backert S. 2012. Host epithelial cell invasion by Campylobacter jejuni: trigger or zipper mechanism? Front Cell Infect Microbiol 2:25. doi: 10.3389/fcimb.2012.00025. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] 15.Backert S, Boehm M, Wessler S, Tegtmeyer N. 2013. Transmigration route of Campylobacter jejuni across polarized intestinal epithelial cells: paracellular, transcellular or both? Cell Commun Signal 11:72. doi: 10.1186/1478-811X-11-72. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B16] 16.Chaloner G, Wigley P, Humphrey S, Kemmett K, Lacharme-Lora L, Humphrey T, Williams N. 2014. Dynamics of dual infection with Campylobacter jejuni strains in chickens reveals distinct strain-to-strain variation in infection ecology. Appl Environ Microbiol 80:6366–6372. doi: 10.1128/AEM.01901-14. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B17] 17.Baig A, Manning G. 2014. Campylobacter association with the human host, p 99–110. In Sheppard SK. (ed), Campylobacter ecology and evolution. Caister Academic Press, Poole, United Kingdom. [Google Scholar]

[B18] 18.Nishimura K, Tajima N, Yoon Y-H, Park S-Y, Tame JRH. 2010. Autotransporter passenger proteins: virulence factors with common structural themes. J Mol Med 88:451–458. doi: 10.1007/s00109-010-0600-y. [DOI] [PubMed] [Google Scholar]

[B19] 19.Henderson IR, Navarro-Garcia F, Nataro JP. 1998. The great escape: structure and function of the autotransporter proteins. Trends Microbiol 6:370–378. doi: 10.1016/S0966-842X(98)01318-3. [DOI] [PubMed] [Google Scholar]

[B20] 20.Leo JC, Grin I, Linke D. 2012. Type V secretion: mechanism(s) of autotransport through the bacterial outer membrane. Philos Trans R Soc Lond B Biol Sci 367:1088–1101. doi: 10.1098/rstb.2011.0208. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B21] 21.Diavatopoulos D, Hijnen M, Mooi F. 2006. Adaptive evolution of the Bordetella autotransporter pertactin. J Evol Biol 19:1931–1938. doi: 10.1111/j.1420-9101.2006.01154.x. [DOI] [PubMed] [Google Scholar]

[B22] 22.Ashgar SSA, Oldfield NJ, Wooldridge KG, Jones MA, Irving GJ, Turner DPJ, Ala'Aldeen DAA. 2007. CapA, an autotransporter protein of Campylobacter jejuni, mediates association with human epithelial cells and colonization of the chicken gut. J Bacteriol 189:1856–1865. doi: 10.1128/JB.01427-06. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23.Friis C, Wassenaar TM, Javed MA, Snipen L, Lagesen K, Hallin PF, Newell DG, Toszeghy M, Ridley A, Manning G, Ussery DW. 2010. Genomic characterization of Campylobacter jejuni strain M1. PLoS One 5:e12253. doi: 10.1371/journal.pone.0012253. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B24] 24.Gundogdu O, Bentley SD, Holden MT, Parkhill J, Dorrell N, Wren BW. 2007. Re-annotation and re-analysis of the Campylobacter jejuni NCTC11168 genome sequence. BMC Genomics 8:162. doi: 10.1186/1471-2164-8-162. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B25] 25.Pearson BM, Gaskin DJH, Segers RPAM, Wells JM, Nuijten PJM, van Vliet AHM. 2007. The complete genome sequence of Campylobacter jejuni strain 81116 (NCTC11828). J Bacteriol 189:8402–8403. doi: 10.1128/JB.01404-07. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] 26.Richardson PT, Park SF. 1998. Molecular characterization of a strain-specific sequence in Campylobacter jejuni. Lett Appl Microbiol 26:113–117. doi: 10.1046/j.1472-765X.1998.00290.x. [DOI] [PubMed] [Google Scholar]

[B27] 27.Drobnak I, Braselmann E, Clark PL. 2015. Multiple driving forces required for efficient secretion of autotransporter virulence proteins. J Biol Chem 290:10104–10116. doi: 10.1074/jbc.M114.629170. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28.Wells TJ, Tree JJ, Ulett GC, Schembri MA. 2007. Autotransporter proteins: novel targets at the bacterial cell surface. FEMS Microbiol Lett 274:163–172. doi: 10.1111/j.1574-6968.2007.00833.x. [DOI] [PubMed] [Google Scholar]

[B29] 29.Henderson IR, Navarro-Garcia F, Desvaux M, Fernandez RC, Ala'Aldeen D. 2004. Type V protein secretion pathway: the autotransporter story. Microbiol Mol Biol Rev 68:692–744. doi: 10.1128/MMBR.68.4.692-744.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B30] 30.Oomen CJ, van Ulsen P, van Gelder P, Feijen M, Tommassen J, Gros P. 2004. Structure of the translocator domain of a bacterial autotransporter. EMBO J 23:1257–1266. doi: 10.1038/sj.emboj.7600148. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31.Petersen TN, Brunak S, von Heijne G, Nielsen H. 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods 8:785–786. doi: 10.1038/nmeth.1701. [DOI] [PubMed] [Google Scholar]

[B32] 32.Horton P, Park K-J, Obayashi T, Fujita N, Harada H, Adams-Collier CJ, Nakai K. 2007. WoLF PSORT: protein localization predictor. Nucleic Acids Res 35(Web Server issue):W585–W587. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B33] 33.Yu C-S, Cheng C-W, Su W-C, Chang K-C, Huang S-W, Hwang J-K, Lu C-H. 2014. CELLO2GO: a web server for protein subCELlular LOcalization prediction with functional gene ontology annotation. PLoS One 9:e99368. doi: 10.1371/journal.pone.0099368. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34.Kelley LA, Mezulis S, Yates CM, Wass MN, Sternberg MJE. 2015. The Phyre2 web portal for protein modeling, prediction and analysis. Nat Protoc 10:845–858. doi: 10.1038/nprot.2015.053. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B35] 35.Zhang Q, Meitzler JC, Huang S, Morishita T. 2000. Sequence polymorphism, predicted secondary structures, and surface-exposed conformational epitopes of Campylobacter major outer membrane protein. Infect Immun 68:5679–5689. doi: 10.1128/IAI.68.10.5679-5689.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B36] 36.Gaskin DJH, Van Vliet AHM, Pearson BM. 2007. The Campylobacter genetic toolbox: development of tractable and generally applicable genetic techniques for Campylobacter jejuni. Zoonotic Public Health 54:101. [Google Scholar]

[B37] 37.de Vries SPW, Gupta S, Baig A, L'Heureux J, Pont E, Wolanska DP, Maskell DJ, Grant AJ. 2015. Motility defects in Campylobacter jejuni defined gene deletion mutants caused by second-site mutations. Microbiology (Reading) 161:2316–2327. doi: 10.1099/mic.0.000184. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B38] 38.de Vries SP, Gupta S, Baig A, Wright E, Wedley A, Jensen AN, Lora LL, Humphrey S, Skovgård H, Macleod K, Pont E, Wolanska DP, L'Heureux J, Mobegi FM, Smith DGE, Everest P, Zomer A, Williams N, Wigley P, Humphrey T, Maskell DJ, Grant AJ. 2017. Genome-wide fitness analyses of the foodborne pathogen Campylobacter jejuni in in vitro and in vivo models. Sci Rep 7:1251. doi: 10.1038/s41598-017-01133-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B39] 39.González-Santoyo I, Córdoba-Aguilar A. 2012. Phenoloxidase: a key component of the insect immune system. Entomol Exp Appl 142:1–16. doi: 10.1111/j.1570-7458.2011.01187.x. [DOI] [Google Scholar]

[B40] 40.Bouwman LI, Niewold P, van Putten JPM. 2013. Basolateral invasion and trafficking of Campylobacter jejuni in polarized epithelial cells. PLoS One 8:e54759. doi: 10.1371/journal.pone.0054759. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B41] 41.Krause-Gruszczynska M, Boehm M, Rohde M, Tegtmeyer N, Takahashi S, Buday L, Oyarzabal OA, Backert S. 2011. The signaling pathway of Campylobacter jejuni-induced Cdc42 activation: role of fibronectin, integrin beta1, tyrosine kinases and guanine exchange factor Vav2. Cell Commun Signal 9:32. doi: 10.1186/1478-811X-9-32. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B42] 42.Hofreuter D. 2014. Defining the metabolic requirements for the growth and colonization capacity of Campylobacter jejuni. Front Cell Infect Microbiol 4:137. doi: 10.3389/fcimb.2014.00137. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B43] 43.Konkel ME, Larson CL, Flanagan RC. 2010. Campylobacter jejuni FlpA binds fibronectin and is required for maximal host cell adherence. J Bacteriol 192:68–76. doi: 10.1128/JB.00969-09. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B44] 44.Eucker TP, Konkel ME. 2012. The cooperative action of bacterial fibronectin-binding proteins and secreted proteins promote maximal Campylobacter jejuni invasion of host cells by stimulating membrane ruffling. Cell Microbiol 14:226–238. doi: 10.1111/j.1462-5822.2011.01714.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B45] 45.van Alphen LB, Wenzel CQ, Richards MR, Fodor C, Ashmus RA, Stahl M, Karlyshev AV, Wren BW, Stintzi A, Miller WG, Lowary TL, Szymanski CM. 2014. Biological roles of the O-methyl phosphoramidate capsule modification in Campylobacter jejuni. PLoS One 9:e87051. doi: 10.1371/journal.pone.0087051. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B46] 46.Pei Z, Burucoa C, Grignon B, Baqar S, Huang XZ, Kopecko DJ, Bourgeois AL, Fauchere JL, Blaser MJ. 1998. Mutation in the peb1A locus of Campylobacter jejuni reduces interactions with epithelial cells and intestinal colonization of mice. Infect Immun 66:938–943. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B47] 47.Hofreuter D, Mohr J, Wensel O, Rademacher S, Schreiber K, Schomburg D, Gao B, Galán JE. 2012. Contribution of amino acid catabolism to the tissue specific persistence of Campylobacter jejuni in a murine colonization model. PLoS One 7:e50699. doi: 10.1371/journal.pone.0050699. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B48] 48.Watson E, Sherry A, Inglis NF, Lainson A, Jyothi D, Yaga R, Manson E, Imrie L, Everest P, Smith DGE. 2014. Proteomic and genomic analysis reveals novel Campylobacter jejuni outer membrane proteins and potential heterogeneity. EuPA Open Proteom 4:184–194. doi: 10.1016/j.euprot.2014.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B49] 49.Tsai CJ-Y, Loh JMS, Proft T. 2016. Galleria mellonella infection models for the study of bacterial diseases and for antimicrobial drug testing. Virulence 7:214–229. doi: 10.1080/21505594.2015.1135289. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B50] 50.Eisenman HC, Duong R, Chan H, Tsue R, McClelland EE. 2014. Reduced virulence of melanized Cryptococcus neoformans in Galleria mellonella. Virulence 5:611–618. doi: 10.4161/viru.29234. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B51] 51.Senior NJ, Bagnall MC, Champion OL, Reynolds SE, La Ragione RM, Woodward MJ, Salguero FJ, Titball RW. 2011. Galleria mellonella as an infection model for Campylobacter jejuni virulence. J Med Microbiol 60:661–669. doi: 10.1099/jmm.0.026658-0. [DOI] [PubMed] [Google Scholar]

[B52] 52.Joyce SA, Gahan CGM. 2010. Molecular pathogenesis of Listeria monocytogenes in the alternative model host Galleria mellonella. Microbiology (Reading) 156:3456–3468. doi: 10.1099/mic.0.040782-0. [DOI] [PubMed] [Google Scholar]

[B53] 53.Askoura M, Sarvan S, Couture J-F, Stintzi A. 2016. The Campylobacter jejuni ferric uptake regulator promotes acid survival and cross-protection against oxidative stress. Infect Immun 84:1287–1300. doi: 10.1128/IAI.01377-15. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B54] 54.Salem HM, Hussein MA, Hafez SE, Hussein MA, Sayed RM. 2014. Ultrastructure changes in the haemocytes of Galleria mellonella larvae treated with gamma irradiated Steinernema carpocapsae BA2. J Radiat Res Appl Sci 7:74–79. doi: 10.1016/j.jrras.2013.12.005. [DOI] [Google Scholar]

[B55] 55.Chain BM, Anderson RS. 1983. Inflammation in insects: the release of a plasmatocyte depletion factor following interaction between bacteria and haemocytes. J Insect Physiol 29:1–4. doi: 10.1016/0022-1910(83)90099-9. [DOI] [Google Scholar]

[B56] 56.Champion OL, Karlyshev AV, Senior NJ, Woodward M, La Ragione R, Howard SL, Wren BW, Titball RW. 2010. Insect infection model for Campylobacter jejuni reveals that O-methyl phosphoramidate has insecticidal activity. J Infect Dis 201:776–782. [DOI] [PubMed] [Google Scholar]

[B57] 57.Harding CR, Schroeder GN, Collins JW, Frankel G. 2013. Use of Galleria mellonella as a model organism to study Legionella pneumophila infection. J Vis Exp 2013:e50964. doi: 10.3791/50964. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B58] 58.Lu A, Zhang Q, Zhang J, Yang B, Wu K, Xie W, Luan Y-X, Ling E. 2014. Insect prophenoloxidase: the view beyond immunity. Front Physiol 5:252. doi: 10.3389/fphys.2014.00252. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B59] 59.Zheng J, Meng J, Zhao S, Singh R, Song W. 2008. Campylobacter-induced interleukin-8 secretion in polarized human intestinal epithelial cells requires Campylobacter-secreted cytolethal distending toxin- and Toll-like receptor-mediated activation of NF-kappaB. Infect Immun 76:4498–4508. doi: 10.1128/IAI.01317-07. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B60] 60.Watson RO, Galán JE. 2005. Signal transduction in Campylobacter jejuni-induced cytokine production. Cell Microbiol 7:655–665. doi: 10.1111/j.1462-5822.2004.00498.x. [DOI] [PubMed] [Google Scholar]

[B61] 61.Jin S, Joe A, Lynett J, Hani EK, Sherman P, Chan VL. 2001. JlpA, a novel surface-exposed lipoprotein specific to Campylobacter jejuni, mediates adherence to host epithelial cells. Mol Microbiol 39:1225–1236. doi: 10.1111/j.1365-2958.2001.02294.x. [DOI] [PubMed] [Google Scholar]

[B62] 62.Pei Z, Blaser MJ. 1993. PEB1, the major cell-binding factor of Campylobacter jejuni, is a homolog of the binding component in gram-negative nutrient transport systems. J Biol Chem 268:18717–18725. [PubMed] [Google Scholar]

[B63] 63.van Alphen LB, Bleumink-Pluym NMC, Rochat KD, van Balkom BWM, Wösten MMSM, van Putten JPM. 2008. Active migration into the subcellular space precedes Campylobacter jejuni invasion of epithelial cells. Cell Microbiol 10:53–66. [DOI] [PubMed] [Google Scholar]

[B64] 64.Pielsticker C, Glünder G, Rautenschlein S. 2012. Colonization properties of Campylobacter jejuni in chickens. Eur J Microbiol Immunol 2:61–65. doi: 10.1556/EuJMI.2.2012.1.9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B65] 65.Hendrixson DR, DiRita VJ. 2004. Identification of Campylobacter jejuni genes involved in commensal colonization of the chick gastrointestinal tract. Mol Microbiol 52:471–484. doi: 10.1111/j.1365-2958.2004.03988.x. [DOI] [PubMed] [Google Scholar]

[B66] 66.Karlyshev AV, Thacker G, Jones MA, Clements MO, Wren BW. 2014. Campylobacter jejuni gene cj0511 encodes a serine peptidase essential for colonisation. FEBS Open Bio 4:468–472. doi: 10.1016/j.fob.2014.04.012. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B67] 67.Baillon ML, van Vliet AH, Ketley JM, Constantinidou C, Penn CW. 1999. An iron-regulated alkyl hydroperoxide reductase (AhpC) confers aerotolerance and oxidative stress resistance to the microaerophilic pathogen Campylobacter jejuni. J Bacteriol 181:4798–4804. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B68] 68.Holt JP, Grant AJ, Coward C, Maskell DJ, Quinlan JJ. 2012. Identification of Cj1051c as a major determinant for the restriction barrier of Campylobacter jejuni strain NCTC11168. Appl Environ Microbiol 78:7841–7848. doi: 10.1128/AEM.01799-12. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B69] 69.Sommerlad SM, Hendrixson DR. 2007. Analysis of the roles of FlgP and FlgQ in flagellar motility of Campylobacter jejuni. J Bacteriol 189:179–186. doi: 10.1128/JB.01199-06. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B70] 70.Elmi A, Watson E, Sandu P, Gundogdu O, Mills DC, Inglis NF, Manson E, Imrie L, Bajaj-Elliott M, Wren BW, Smith DGE, Dorrell N. 2012. Campylobacter jejuni outer membrane vesicles play an important role in bacterial interactions with human intestinal epithelial cells. Infect Immun 80:4089–4098. doi: 10.1128/IAI.00161-12. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B71] 71.Javed MA, Cawthraw SA, Baig A, Li J, McNally A, Oldfield NJ, Newell DG, Manning G. 2012. Cj1136 is required for lipooligosaccharide biosynthesis, hyperinvasion, and chick colonization by Campylobacter jejuni. Infect Immun 80:2361–2370. doi: 10.1128/IAI.00151-12. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B72] 72.Reuter M, van Vliet AHM. 2013. Signal balancing by the CetABC and CetZ chemoreceptors controls energy taxis in Campylobacter jejuni. PLoS One 8:e54390. doi: 10.1371/journal.pone.0054390. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

CapC, a Novel Autotransporter and Virulence Factor of Campylobacter jejuni

Jai W Mehat

Simon F Park

Arnoud H M van Vliet

Roberto M La Ragione

Roles

ABSTRACT

INTRODUCTION

RESULTS

Characterization of a novel Campylobacter autotransporter protein.

FIG 1.

capC encodes an outer membrane protein that does not affect C. jejuni growth.

FIG 2.

Inactivation of capC causes decreased virulence in the Galleria mellonella insect model.

FIG 3.

FIG 4.

CapC is required for maximal adhesion to Caco-2 and T84 intestinal epithelial cells.

FIG 5.

CapC contributes to IL-8 secretion but does not affect cytotoxicity.

FIG 6.

DISCUSSION

MATERIALS AND METHODS

Bacterial strains and culture conditions.

Bioinformatic tools and sequence analysis.

Generation of capC-deficient mutants.

TABLE 1.

Isolation of cellular fractions.

Antiserum generation and immunoblot analysis.

Galleria mellonella virulence model.

Cell lines, media, and culture conditions.

Adhesion and invasion assays.

Cytotoxicity assay.

ELISA for IL-8.

Statistical analysis.

Supplementary Material

ACKNOWLEDGMENT

Footnotes

REFERENCES

Associated Data

Supplementary Materials

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases