Table 1.

Primer pair sequences and amplification characteristics for the amplification of promoter-specific CYP19 expression in Hs578t cells.

CYP19 promoter	Primer pairs (5′–3′)	Amplification characteristics in Hs578t	Tissue-specific expression	Reference and NCBI accession number
CYP19-coding region	Fw: TGTCTCTTTGTTCTTCATGCTATTTCTC	Standard curve: $r^2=0.991$	Detects all aromatase transcripts regardless of promoter utilized	Sanderson et al. 2000)
	Rv: TCACCAATAACAGTCTGGATTTCC	Efficiency: 92.8%		M22246
CYP19-I.4	Fw: GGCTCCAAGTAGAACGTGACCAACTG	Standard curve: $r^2=0.941$	Expressed in fibroblasts in the normal mammary gland	Heneweer et al. 2004)
	Rv: CAGCCCAAGTTTGCTGCCGAA	Efficiency: 101.9%		S52794
CYP19-PII	Fw: TCTGTCCCTTTGATTTCCACAG	Standard curve: $r^2=0.937$	Expressed in ovaries, testes and stroma of breast cancer patients	Heneweer et al. 2004)
	Rv: GCACGATGCTGGTGATGTTATA	Efficiency: 108.9%		S52794
CYP19-I.3	Fw: GGGCTTCCTTGTTTTGACTTGTAA	Standard curve: $r^2=0.969$	Expressed in ovaries, testes and stroma of breast cancer patients	Wang et al. 2008)
	Rv: AGAGGGGGCAATTTAGAGTCTGTT	Efficiency: 95.7%		D30796
CYP19-I.7	Fw: ACACTCAGCTTTTTCCCAACA	Standard curve: $r^2=0.983$	Expressed in endothelial cells and stroma of breast cancer patients	NM_001347251
	Rv: TTTCACCCCTTTCTCCGGTC	Efficiency: 90.7%

Note: Fw, forward; NCBI, National Center Biotechnology Information; Rv, reverse.