Mitochondria-targeted small molecule SS31: a potential candidate for the treatment of Alzheimer’s disease

Abstract

The objective of our study was to better understand the protective effects of the mitochondria-targeted tetra-peptide SS31 against amyloid beta (Aβ)-induced mitochondrial and synaptic toxicities in Alzheimer’s disease (AD) progression. Using intraperitoneal injections, we administered SS31 to an AD mouse model (APP) over a period of 6 weeks, beginning when the APP mice were 12 months of age. We studied their cortical tissues after SS31 treatment and determined that SS31 crosses the blood brain barrier and reaches mitochondrial sites of free radical production. We also determined: (1) plasma and brain levels of SS31, (2) mRNA levels and levels of mitochondrial dynamics, biogenesis proteins and synaptic proteins, (3) soluble Aβ levels and immunoreactivity of mutant APP and Aβ levels and (4) mitochondrial function by measuring H₂O₂, lipid peroxidation, cytochrome c oxidase activity and mitochondrial ATP. We found reduced mRNA expression and reduced protein levels of fission genes, and increased levels of mitochondrial fusion, biogenesis and synaptic genes in SS31-treated APP mice relative to SS31-untreated APP mice. Immunofluorescence analysis revealed reduced full-length mutant APP and soluble/insoluble Aβ levels in the SS31-treated APP mice. Sandwich ELISA assays revealed significantly reduced soluble Aβ levels in the SS31-treated APP mice relative to the untreated APP mice. Mitochondrial function was maintained in the SS31-treated APP mice over the 6 weeks of SS31 treatment compared with mitochondrial function in the untreated APP mice. Our findings indicate that SS31 treatment reduces Aβ production, reduces mitochondrial dysfunction, maintains mitochondrial dynamics and enhances mitochondrial biogenesis and synaptic activity in APP mice; and that SS31 may confer protective effects against mitochondrial and synaptic toxicities in APP transgenic mice.

Introduction

Alzheimer’s disease (AD) is a progressive, degenerative disorder manifested by dementia in aged individuals (1). Currently, over 46.8 million people live with AD-related dementia worldwide, and this number is estimated to increase to 131.5 million by 2050 (2). AD-related dementia has huge economic consequences, with the total worldwide medical cost of dementia estimated at $818 billion in 2015. By 2018, AD, including AD-related dementia, is expected to become a trillion-dollar disease (2). In addition to dementia, AD is associated with the loss of synapses, synaptic dysfunction, mitochondrial structural and functional abnormalities, inflammatory responses, neuronal loss, extracellular neuritic plaques and intracellular neurofibrillary tangles (1,3–12). Despite the progress that has been made in better understanding AD pathogenesis, there are still no early detectable markers, drugs or agents that can delay or prevent AD.

Several decades of research have revealed that mitochondrial dysfunction and synaptic damage are early events in the AD disease process. Mitochondria play several key roles in synaptic maintenance (13), including assisting in the generation of adenosine triphosphate (ATP) and the regulation of Ca²⁺, both of which are essential for neuronal viability. In the case of ATP generation, it has long been recognized that neuronal activity can stimulate oxidative phosphorylation. However, several studies found decreased mitochondrial ATP production in postmortem AD brains compared with brains from age-matched subjects who did not have AD (9–11,14,15). Further, using AD transgenic mouse lines, studies have found reduced levels of mitochondrial ATP in AD-affected brain regions (cortex and hippocampus) (16–24) and in the primary neurons of AD transgenic mice and in neurons expressing mutant APP and Aβ (25,26). These findings support mitochondrial dysfunction and oxidative stress as largely involved in AD pathogenesis. However, there are no pre-clinical studies, such as studies using AD mouse models (APPs), to determine whether particular mitochondria-targeted molecules, such as SS31, can reduce mitochondria-generated free radicals. If such molecules can be identified in pre-clinical studies, then clinical studies can be designed to determine whether these molecules can trigger a reduction in mitochondria-generated free radicals and synaptic ATP in persons with AD and whether, in turn, mitochondria and synaptic toxicities can be reduced or the progression of AD symptoms can be slowed.

Synaptic damage and the loss of synapses are the best correlates of cognitive decline, and they are critical factors responsible for cognitive decline in aged individuals and in patients with AD (7,9–12,15,27,28). Using electron microscopy, several studies investigated the connection between synaptic loss and cognitive decline in AD (12,28). These researchers found a 25–30% decrease in synapses in the cortex and a 15–35% decrease in synapses per cortical neuron, suggesting the hypothesis that synaptic loss correlates with cognitive decline in AD patients more than does the number of Aβ plaques, the number of intracellular neurofibrillary tangles, or the extent of neuronal loss. Several researchers investigating synaptic proteins in AD patients and healthy control subjects found fewer pre- and post-synaptic proteins in AD patients in comparison to control subjects, suggesting that pre- and post-synaptic proteins may be critically involved in AD progression (29–31). However, there are no pre-clinical studies, using APPs and mitochondria-targeted molecules such as SS31 in AD.

Recent mitochondrial and Aβ studies found Aβ monomers and oligomers in mitochondrial membranes, in the neurons of postmortem brain specimens from AD patients and AD mice, and in neurons expressing mutant APP (18,32–34). Further, recent evidence from our lab (25,26,35) and others (36–38) suggest that impaired mitochondrial dynamics (increased mitochondrial fission and decreased fusion) is present in neurons affected by AD. Further, recent studies from our lab revealed that Aβ interacts with Drp1, with a subsequent increase in free radical production, which in turn activates Drp1 and Fis1, and causes excessive mitochondrial fragmentation, defective transport of mitochondria to synapses, low synaptic ATP and synaptic dysfunction in AD neurons (26,35). Given the increase in free radical production and excessive fragmentation in mitochondria that are involved in AD, we hypothesize that drugs capable of reducing free radicals and/or decreasing excessive fragmentation in mitochondria may be an effective therapeutic approach to treat patients with AD.

Studies have been conducted to assess whether natural antioxidants are capable of preventing or delaying the onset of AD and its symptoms (11,39). These antioxidants have provided only limited success in the clinical trials of AD patients (11,39). There have also been multiple clinical trials to test the efficacy of antioxidants in AD patients; these antioxidants include vitamin E (11,39), epigallocatechin gallate, resveratrol, curcumin, pramipexole, latrepirdine, ubiquinone, lipoic acid, idebenone, Ginkgo biloba and N-acetylcysteine (40). Many non-traditional antioxidants, such as VitC, VitE, beta carotene and G.biloba, are known to modulate glutathione levels in the brain. Glutathione is an antioxidant that has been found to be lower in AD neurons than in non-diseased neurons. Glutathione has been proposed as a potential treatment in AD (41). Unfortunately, only a few clinical trials testing the efficacy of glutathione have yielded positive results, with several showing a negative association between antioxidant supplementation and positive outcomes. Research into the efficacy of traditional antioxidants in AD faces a variety of physiological challenges; include limited penetrating and crossing the blood brain barrier (15).

Because oxidative damage in mitochondria is thought to drive mitochondrial dysfunction, investigators have begun assessing the efficacy of antioxidant therapies specifically designed to prevent or delay mitochondrial dysfunction. Several mitochondria-targeted antioxidants have been developed and are currently undergoing pre-clinical testing. Such antioxidants include MitoQ, MitoVitE, MitoPBN, MitoPeroxidase, glutathione choline esters, latripiridine and Szeto-Schiller (SS) peptides (7,11,42–45). One of the most promising mitochondria-targeted antioxidants from these studies is SS31 (7,44).

SS31 is a cell-permeable tetra-peptide. It was synthesized as a part of a series of SS peptides—SS02, SS19, SS20, SS31—that are characterized as opioid agonists (46,47). SS31 was found, in vitro, to inhibit lipid peroxidation and H₂O₂ scavenging (47). Furthermore, SS31 was found to protect neurons from Ca²⁺-induced mitochondrial depolarization swelling, to release cytochrome c in isolated organelles, and to protect against ischemia reperfusion injury in the guinea pig heart (47). SS31 was also evaluated in rat models of islet cell transplantation (48), myocardial infarction (49), brain ischemia reperfusion (49) and ALS (50). Strikingly, SS31 was found to be beneficial in all of these conditions.

We recently, evaluated SS31 in rodent cell models of AD, including Aβ-treated neuroblastoma (N2a) cells and primary neurons from APP mice, in order to determine whether SS31 is protective against Aβ toxicity in AD (25). In N2a cells treated with Aβ25-35, we observed a range of problems in the mitochondria. Mitochondrial fission genes and proteins were up-regulated, whereas fusion genes and proteins were down-regulated. There was also an accumulation of small, apparently fragmented mitochondria within the N2a cell body. Further, Aβ25-35 treatment was associated with increased H₂O₂ production, decreased cytochrome oxidase activity (COX) activity, and decreased ATP (25). In N2a cells treated with only SS31, we observed increased expression of mitochondrial fusion genes, decreased H₂O₂ production, increased COX activity and increased ATP levels, suggesting that SS31 reduces mitochondrial dysfunction and oxidative stress (25). Our lab also evaluated the efficacy of SS31, using primary neurons from APP mice. Primary neurons are known to be deficient in synaptic markers and to exhibit dendritic simplification due to excreted Aβ and intracellular accumulation of oligomeric Aβ (51–53). We found that, in addition to synaptic loss, aged primary neurons from APP mice exhibited increased numbers of rounded and structurally damaged mitochondria. Further, we found significantly decreased anterograde moving mitochondria and defective mitochondrial function in APP primary neurons. On the contrary, we found restored mitochondrial transport and synaptic viability, and decreased the percentage of defective mitochondria in SS31 treated APP primary neurons, indicating that SS31 protects mitochondria and synapses from Aβ toxicity in APP primary neurons. However, there are no studies focusing on whether SS31 treatment of AD mice affects mitochondrial and synaptic alterations.

In the current study, we sought to determine the protective effects of mitochondria-targeted molecule SS31 in 12-month-old APP mice. We administered SS31 using intraperitoneal injections for a period of 6 weeks and studied: (1) mitochondrial fission machinery and fusion activity, (2) free radical production, (3) mitochondrial biogenesis, (4) SS31 enhances synaptic activity, (5) mitochondrial function, (6) soluble Aβ levels and (7) immunoreactivities of full-length APP and soluble/insoluble Aβ.

Results

SS31, and plasma and brain levels in wild-type (WT) mice

To determine whether SS31 crosses the blood brain barrier and reaches mitochondria, using intraperitoneal injections we administered SS31 (5 mg/kg body weight) twice a week for 6 weeks in a 12-month-old C57BL6 mice (n = 6). PBS-treated WT mice (n = 5) served as our control. We euthanized and harvested the brains of all SS31-treated WT mice after they underwent 6 weeks of SS31 treatment. We also collected blood to determine SS31 levels in the plasma of both groups. As shown in Figure 1, we found sufficient levels of SS31 in the plasma and brain in the SS31-treated mice, indicating that SS31 crosses the blood brain barrier and reaches neuronal mitochondria.

Figure 1.

Plasma and brain levels of wild-type mice. X-axis shows the number of 12-month-old wild-type mice that were studied and Y-axis shows picograms of SS31 in plasma (red) and brain (blue) for log10.

APP mice and SS31 treatment

After checking the BBB status, we administered SS31 (5 mg/kg body weight), twice a week for 6 weeks in 12-month-old APP mice (Tg2576 line) (n = 5) and PBS-treated APP mice (n = 5) as controls. After 6 weeks treatment, we euthanized all the mice, harvested brains for mRNA, protein levels, mitochondrial functional parameters and soluble Aβ levels and immunoreactivity of full-length APP and soluble/insoluble Aβ.

mRNA levels in SS31-treated and untreated APP mice

Mitochondrial dynamics genes. mRNA expression levels significantly decreased in Drp1, by 2.7-fold (P = 0.001); and in Fis1, by 2.4-fold (P = 0.04) (Table 1) in APP mice relative to SS31 treated APP mice. In contrast, the fusion genes were significantly increased in the SS31-treated APP mice: Mfn1 by 3.0-fold (P = 0.001), Mfn2 by 2.2 (P = 0.04) and Opa1 by 2.1-fold (P = 0.01). These observations indicate SS31 reduces fission machinery and enhances fusion activity in 12-month-old APP mice.

Table 1.

Fold changes of mRNA expression of mitochondrial structural, synaptic genes and biogenesis genes in SS31-injected APP mice relative to the APP mice

	Genes	mRNA fold changes
		APP-SS31
Mitochondrial structural genes	Drp1	−2.7**
	Fis1	−2.4*
	Mfn1	3.0**
	Mfn2	2.2*
	OPA1	2.1*
Synaptic genes	Synaptophysin	2.2**
	PSD95	5.1**
Biogenesis gens	PGC1α	3.0**
	Nrf1	3.4**
	Nrf2	2.1*
	TFAM	2.5**

* P<0.05; ** P<0.005

Mitochondrial biogenesis genes. As shown in Table 1, significantly increased mRNA levels of mitochondrial biogenesis were found in the SS31-treated APP mice—PGC1α by 3.0 (P = 0.001), Nrf1 by 3.4-fold (P = 0.003), Nrf2 by 2.1-fold (P = 0.01) and TFAM by 2.5-fold (P = 0.004). These observations suggest that SS31 enhances mitochondrial biogenesis activity.

Synaptic genes. mRNA levels of synaptic genes were significantly increased in the SS31-treated APP mice: synaptophysin by 2.2-fold (P = 0.004) and PSD95 by 5.1-fold (P = 0.001) (Table 1). These findings suggest that SS31 enhances synaptic activity in 12-month-old APP mice.

Immunoblotting analysis

To determine the protective effects of SS31 on mitochondrial dynamics and biogenesis, and synaptic proteins, we quantified mitochondrial and synaptic proteins in the cortical tissues of the APP mice that were treated with SS31.

Mitochondrial dynamics proteins. In the SS31-treated APP mice relative to the untreated APP mice, the mitochondrial fission proteins Drp1 (P = 0.02) and Fis1 (P = 0.01) (Fig. 2A and B) were significantly reduced. Also in the SS31-treated APP mice, the mitochondrial fusion proteinsMfn1 (P = 0.02) and Mfn2 (P = 0.04) were significantly higher compared with the untreated APP mice. These findings suggest that SS31 affects mitochondrial dynamics in APP mice.

Figure 2.

Immunoblotting analysis of mitochondrial dynamics proteins. (A) Shows representative immunoblotting analysis of mitochondrial dynamics and synaptic proteins in 12-month-old SS31-treated and untreated APP mice. (B) Shows quantitative densitometry analysis of the mitochondrial dynamics proteins Drp1, Fis1, Mfn1 and Mfn2; and the synaptic proteins synaptophysin and PSD95. Drp1 (P = 0.02) and Fis1 (P = 0.01) were significantly reduced; and Mfn1 (P = 0.02) and Mfn2 (P = 0.04) were significantly higher in the SS31-treated APP mice relative to the untreated APP mice, indicating that SS31 protects against mutant APP and also against Aβ-induced mitochondrial dynamics toxicity. Synaptophysin (P = 0.03) and PSD95 (P = 0.02) were significantly higher in the SS31-treated APP mice relative to the untreated APP mice, indicating that SS31 enhances synaptic activity.

Synaptic proteins. Synaptophysin (P = 0.03) and PSD95 (P = 0.02) levels were significantly increased in the SS31-treated APP mice relative to the untreated APP mice (Fig. 2A and B).

Mitochondrial biogenesis proteins. In the SS31-treated APP mice, the mitochondrial biogenesis proteins PGC1α (P = 0.003), Nrf1 (P = 0.01), Nrf2 (P = 0.002) and TFAM (P = 0.001) were significantly higher relative to the untreated APP mice (Fig. 3A and B). This finding suggests SS31 enhances mitochondrial biogenesis activity.

Figure 3.

Immunoblotting analysis of mitochondrial biogenesis proteins. (A) Shows representative immunoblotting analysis of mitochondrial biogenesis proteins in 12-month-old SS31-treated and untreated APP mice. (B) Shows quantitative densitometry analysis of mitochondrial biogenesis proteins. The levels of PGC1α (P = 0.003), Nrf1 (P = 0.01), Nrf2 (P = 0.002) and TFAM (P = 0.001) were significantly higher in the SS31-treated APP mice relative to the untreated APP mice, indicating that SS31 enhances mitochondrial biogenesis.

Immunofluorescence analysis

Using immunofluorescence analysis, we assessed the localization and quantification of mitochondrial dynamics, mitochondrial biogenesis and synaptic proteins in SS31-treated and untreated APP mice.

Mitochondrial dynamics proteins. As shown in Figure 4A and B, significantly lower levels of Drp1 (P = 0.01) and significantly higher levels of Mfn1 (P = 0.02) and Mfn2 (P = 0.01) were found in the SS31-treated APP mice relative to the untreated APP mice. These findings suggest SS31 alters mitochondrial dynamics proteins in APP mice.

Figure 4.

Immunofluorescence analysis of mitochondrial dynamics proteins. (A) Represents immunofluorescence analysis of mitochondrial dynamics proteins. (B) Represents quantitative immunofluorescence analysis of these proteins. The fission protein Drp1 (P = 0.01) was significantly reduced; and Mfn1 (P = 0.02) and Mfn2 (P = 0.01) were significantly increased in the SS31-treated APP mice relative to the untreated APP mice.

Mitochondrial biogenesis. As shown in Figure 5A and B, we found significantly higher levels of the mitochondrial biogenesis proteins PGC1α (P = 0.03), Nrf1 (P = 0.001), Nrf2 (P = 0.03) and TFAM (P = 0.01) in the SS31-treated APP mice relative to the untreated APP mice, indicating that SS31 enhances mitochondrial biogenesis in APP mice.

Figure 5.

Immunofluorescence analysis of mitochondrial biogenesis proteins. (A) Represents immunofluorescence analysis of the mitochondrial biogenesis proteins. (B) Represents quantitative immunofluorescence analysis. Significantly higher levels of PGC1α (P = 0.03), Nrf1 (P = 0.001), Nrf2 (P = 0.03) and TFAM (P = 0.01) were found in the SS31-treated APP mice relative to the untreated APP mice.

Synaptic proteins. Significantly higher levels of synaptophysin (P = 0.001) and PSD95 (P = 0.002) were found in the SS31-treated APP mice relative to the untreated APP mice (Fig. 6A and B), indicating that SS31 enhances synaptic activity by increasing proteins levels.

Figure 6.

Immunofluorescence analysis of synaptic proteins. (A) Represents immunofluorescence analysis of synaptic proteins. (B) Represents quantitative immunofluorescence analysis of these proteins. Synaptophysin (P = 0.001) and PSD95 (P = 0.002) were significantly higher in the SS31-treated APP mice relative to the untreated APP mice.

Mutant APP and Aβ immunoreactivity

To determine whether SS31 reduces mutant APP and Aβ levels in SS31-treated APP mice, we performed immunostaining and immunofluorescence analysis of midbrain sections from the SS31-treated mice. As shown in Figure 7A and B, significantly lower immunoreactivity levels were found in the SS31-treated APP mice (P = 0.002) relative to the untreated APP mice, suggesting SS31 reduces mutant APP and soluble/insoluble Aβ.

Figure 7.

Immunofluorescence analysis of mutant APP and soluble/insoluble Aβ. (A) Represents immunofluorescence analysis of mutant APP and Aβ deposits. (B) Represents quantitative immunofluorescence analysis of the mutant APP and soluble/insoluble Aβ. Immunoreactivity levels were significantly lower in the SS31-treated APP mice relative to the untreated APP mice (P = 0.002), indicating that SS31 reduces mutant APP and soluble/insoluble A in the APP mice.

Soluble Aβ levels in the SS31-treated and untreated APP mice

Using sandwich ELISA, we measured soluble Aβ42 and Aβ40 levels to determine the effects of SS31 on soluble Aβ levels. As shown in Figure 8A and B, significantly lower levels of Aβ42 (P = 0.01) and Aβ40 (P = 0.02) were found in the SS31-treated APP mice relative to the untreated APP mice. These findings indicate that SS31 affects Aβ levels in APP mice.

Figure 8.

Soluble Aβ levels in SS31 treated and untreated APP mice. (A) Represents the levels of soluble Aβ42 and (B), the levels of Aβ40 in the SS31-treated APP mice relative to the untreated APP mice. Significantly lower levels of Aβ42 (P = 0.01) and Aβ40 (P = 0.02) were found in the 12-month-old SS31-treated APP mice relative to the untreated APP mice.

Mitochondrial function

Mitochondrial function was assessed in the SS31-treated APP mice by measuring H₂O₂, lipid peroxidation, cytochrome c oxidase activity and mitochondrial ATP. As shown in Figure 9A, significantly decreased levels of H₂O₂ were found in the SS31-treated APP mice relative to the untreated APP mice (P = 0.001). Similar to H₂O₂, 4-hydroxy-2-nonenol (HNE), an indicator of lipid peroxidation was significantly lower in the SS31-treated APP mice relative to the untreated APP mice (P = 0.01) (Fig. 9B). Significantly higher levels of COX were found in the SS31-treated APP mice (P = 0.02) relative to the untreated APP mice (Fig. 9C). In addition, significantly higher levels of mitochondrial ATP were found in the SS31-treated APP mice relative to the untreated APP mice (P = 0.02) (Fig. 9D).

Figure 9.

Mitochondrial functional parameters in 12-month-old SS31-treated and untreated APP mice. Mitochondrial function was assessed by measuring: (A) H₂O₂ production, (B) lipid peroxidation, (C) cytochrome oxidase activity and (D) levels of ATP. Levels of H₂O₂ (P = 0.001) (A) and 4-hydroxy-2-nonenol (P = 0.01) (B) were significantly higher and the levels of cytochrome oxidase (P = 0.02) (C) and ATP (P = 0.02) (D) were significantly lower in the SS31-treated APP mice relative to the untreated APP mice.

Discussion

The objective of our study was to understand the protective effects against mutant APP/Aβ-induced mitochondrial and synaptic toxicities in AD progression. Lower mRNA expressions and protein levels of fission genes, and higher levels of mitochondrial fusion, mitochondrial biogenesis, and synaptic genes and proteins were found in the SS31-treated APP mice relative to the untreated APP mice. Immunoblotting and immunofluorescence analyses revealed reduced full-length mutant APP and Aβ deposit levels in the SS31-treated APP mice. Sandwich ELISA assays revealed significantly reduced soluble Aβ levels in the SS31-treated APP mice relative to the untreated APP mice. Mitochondrial function was maintained in the SS31-treated APP mice relative to the untreated APP mice. These findings suggest that SS31 can reduce Aβ production, reduces mitochondrial dysfunction, maintains mitochondrial dynamics and enhances mitochondrial biogenesis and synaptic activity in APP mice. These findings have implications for the development of small molecule-based therapeutics for AD patients.

SS31 levels in the plasma and brain

Assessing plasma and brain levels of a drug molecule is the initial step before using the molecules in clinical trials. In the current study, following SS31 treatment, we carefully monitored plasma levels. We tested two doses—2- and 5-mg of SS31 per kg body weight—and found that the WT mice tolerated SS31 well and showed no adverse reactions, and the 5 mg dose also resulted in more distinct beneficial effects. Other researchers also found the 5 mg dose of SS31 per kg body weight to be protective in a mouse model of ALS (SOD mouse model) (50), in a mouse model of brain ischemia perfusion (49) and in a mouse model of myocardial infarction (49).

As shown in Figure 1, we found a 10:1 ratio of plasma to the brain tissues of the untreated WT mice, and we expect similar ratios in the SS31-treated APP mice. The 10:1 ratio was sufficient to determine cellular and molecular changes in the plasma from the APP mice.

SS31, mRNA levels and protein levels

Abnormal mitochondrial dynamics—increased fission and decreased fusion and increased production of free radicals and reduced synaptic activity—have been extensively reported in postmortem brain tissues from AD patients (25,26,35–37,54–57). SS31 has been found to be capable of reducing and/or scavenging free radicals in the mitochondria and protecting mitochondria and neurons from aging- and Aβ-induced oxidative insults (7). Further, in cell culture studies, SS31 was found to reduce excessive mitochondrial fragmentation, to increase fusion, and to increase synaptic gene expressions (25,26). In the current study, we found reduced excessive mitochondrial fragmentation by decreasing Drp1 and Fis1 levels and enhanced mitochondrial fusion by increasing Mfn1, Mfn2 and Opa1 and enhanced synaptic activities by increasing the levels of synaptophysin and PSD95 in the SS31-treated APP mice relative to the untreated APP mice. Further, our protein data—reduced levels of Drp1 and Fis1, increased levels of Mfn1, Mfn2 and Opa1, and increased levels of synaptophysin and PSD95 in the SS31-treated APP mice—were similar to our mRNA data showing increased synaptic proteins in the SS31-treated APP mice. These findings strongly suggest that SS31 is a promising drug target to increase synaptic and mitochondrial functions in AD neurons since hallmark symptoms of APP (e.g. excessive free radical production, impaired mitochondrial dynamics and mitochondrial dysfunction) were reduced in the SS31-treated mice.

Reduced full-length APP and reduced Aβ levels

It is well documented that an age-dependent increase in levels of full-length APP and Aβ occurs in patients with AD (35,42) and in APPs (54,55,58–62). Further, age- and Aβ-induced excessive production of free radicals is key factors known to damage mitochondrial and synaptic functions in AD neurons (11,42,63–66). In assessing the levels of full-length APP, soluble Aβ and Aβ deposits in the SS31-treated APP mice compared with the untreated APP mice, we found significantly reduced levels of soluble Aβ, reduced levels of immunoreactivity mutant APP and reduced levels of Aβ deposits. Taken together, these findings suggest that SS31 reduces mutant full-length APP and soluble Aβ, and Aβ deposits in APP mice.

Mitochondrial function

Synaptic ATP is critical for multiple synaptic functions at nerve terminals, including neurotransmitter release, neurite outgrowth, synaptic vesicle fusion and synapse formation. To maintain sufficient levels of ATP at a synapse, large numbers of functionally active mitochondria are required. In addition, active mitochondrial transport is an important factor in neurons is defective in AD neurons. To maintain synaptic ATP, synapses require large numbers of functionally active mitochondria. Mitochondria are synthesized at the cell soma and travel along axons and dendrites to nerve terminals, the synapses. In a diseased state, such as AD, mitochondria accumulate in the perinuclear region of cytoplasm and do not move to synapses (26,36,37). In other words, the transport of mitochondria to synapses is impaired in AD neurons, mainly due to increased free radical production in the mitochondria and excessive fragmentation of the mitochondria. In a study in which we sought to determine the protective effects of SS31 in APP mice. We found that APP neurons treated with SS31 exhibited significantly increased motile and anterograde movement of mitochondria relative to the untreated APP neurons, suggesting that, in AD neurons, SS31 reduces mitochondrial fragmentation and toxicity, and enhances mitochondrial transport and function (13,26). In the current study, in the SS31-treated APP mice, mitochondrial function increased. This increase may have been due to increased mitochondrial ATP, COX, reduced free radicals, and reduced oxidative stress that were found in the SS31-treated APP mice (Fig. 9). Our mitochondrial functional data were, consistent with the gene expression and protein data of in the SS31-treated APP mice. In the presence of mutant APP and Aβ, SS31 reduced free radicals and lipid peroxidation, and increased mitochondrial ATP and COX, suggesting that SS31 may be a promising drug molecule to treat patients with AD.

SS31 metabolizes quickly and disintegrate in cells (data not shown); as a result, constant administration of SS31 was necessary in order to maintain SS31 levels in the plasma and brain tissues of the SS31-treated APP mice. We found no adverse effects of the SS31 treatment thus far in our APP mice.

Future studies

In the future studies, we plan to assess SS31 in both preventive (2–8 months) and curative (12–18 months) stages in APP and tau mice, and will assess the cognitive behavior, biochemical/molecular and ultrastructural analyses.

Materials and Methods

Mice, SS31 administration, and tissue preparation

We purchased an Aβ pre-cursor protein (APP) mouse model (Tg2576) (Taconic Farms, NY, USA) and used for our experiments.

The APP mice were generated with the mutant human APP gene 695 amino acid isoform and a double mutation (Lys⁶⁷⁰Asn and Met⁶⁷¹Leu) (Swedish mutation) (59). This mouse line exhibits an age-dependent appearance of Aβ plaques, as well as the distribution of Aβ plaque confined to the cerebral cortex and the hippocampus. The human APP transgene was maintained in C57BL6/SJL backgrounds. The APP mouse model has been found to exhibit cognitive impairment 6 months of age and older. To determine transgene-positive mice for human APP, we performed genotyping in accordance with our Institutional policy on genotype tissue collection, using DNA prepared from tail biopsy and PCR amplification, as described in Hsiao et al. (59).

All of the mice were observed daily by a veterinary caretaker and also examined twice a week by laboratory staff. Any mice showing pre-mature signs of neurological deterioration were euthanized before experimentation, according to procedures for euthanasia approved by our university’s Institutional Animal Care and Use Committee, and were not used in the study.

Using intraperitoneal injections, we administered SS31 (n = 5) and/or PBS (n = 5) in the APP mice (5 mg/kg body weight) twice a week for 6 weeks, beginning when the mice were 12 months of age. The beginning treatment at age 12 months of age was selected because at 12 months of age APP mice show Aβ deposits. The two groups of mice were: (1) AP P + SS31 (APP mice treated with SS31) and (2) APP mice not treat with SS31 (untreated). For the first 2 weeks of injections, the mice exhibited no neurological deterioration or ill health, and they showed no beneficial effects. Following the next 6 weeks of injections, we tested them to determine any ill or beneficial effects.

Assessment of plasma and brains levels following SS31 treatment

The APP mice (treated with SS31 and untreated) were decapitated. Their blood was collected in heparinized tubes and centrifuged at 2000g for 15 min at 4°C. Collected plasma (200 µl) was gently vortexed with acetonitrile (1.8 ml) for 30 s and centrifuged at 14 000g for 15 min. Supernatant was collected. The final supernatant underwent high performance liquid chromatography (HPLC) analysis. A fresh cortex brain sample was transferred to tared homogenization vials, and mass was recorded. Three zirconia spheres were added to each vial, and a 9-fold vol/mass of acetonitrile was added for 5 min, for homogenization. Homogenization was performed four times (30 s each) for each vial, using a Bead Bug Microtube Homogenizer, at 4000 vibrations/min. After each homogenization, the vials were iced for 5 min. After final homogenization, the vials were kept in a − 20°C freezer for 10 min and then were centrifuged at 14.8g for 15 min. Supernatants were transferred to Eppendorf vials for vacuum evaporation. Then each sample was reconstituted with 60 µl of 5% acetonitrile dissolved in water. Twenty microliter of the sample was injected for HPLC C18 column using the following HPLC conditions: Kinetex 5µ XB-C-18 column 100A 50 mm × 2.1 mm, column temperature 25 °C. Eluent flow was used at 200 µl/min (a) with water and (b) with acetonitrile, each containing 0.1% of formic acid: 5% acetronitrile for 1 min followed by a 4-min ramp to 90% acetronitrile, which was maintained for 6 min before returning to 5% and equilibrating for 1 min. The Thermo Scientific Exactive Mass Spectrometer with High Resolution Orbitrap Detector was used with X-calibur software for instrument control, data analysis, and sample quantitation. A low-concentration level of standard solution SS31 was used in the range of 15–1000 pg/µl. For SS31 plasma analysis, 20 µl samples were injected manually and separated on a narrow bore column, using a mobile phase via a solvent delivery pump.

Quantitative real-time RT-PCR

Using the reagent TriZol (Invitrogen, City, ST, USA), total RNA was isolated from cortical tissues from the untreated APP mice and the SS31-treated APP mice. Using primer express software (Applied Biosystems, Carlsbad, CA, USA), we designed the oligonucleotide primers for the housekeeping genes β-actin and GAPDH; and for the mitochondrial structural genes; the fission genes Drp1 and Fis1; the fusion genes MFN1, MFN2 and Opa1; and the synaptic genes synaptophysin and PSD95. The primer sequences and amplicon sizes are listed in Table 2. Using SYBR-Green chemistry-based quantitative real-time RT-PCR, we measured mRNA expression of the above-mentioned genes, as described in Manczak and Reddy (67).

Table 2.

Summary of quantitative real-time RT-PCR oligonucleotide primers used in measuring mRNA expression in mitochondrial dynamics, mitochondrial biogenesis, synaptic, and housekeeping genes in 12-month-old SS31-treated and untreated APP mice

Gene	DNA sequence (5′-3′)	PCR product size
Mitochondrial dynamics genes
Drp1	Forward primer ATGCCAGCAAGTCCACAGAA	86
	Reverse primer TGTTCTCGGGCAGACAGTTT
Fis1	Forward primer CAAAGAGGAACAGCGGGACT	95
	Reverse primer ACAGCCCTCGCACATACTTT
MFN1	Forward primer GCAGACAGCACATGGAGAGA	83
	Reverse primer GATCCGATTCCGAGCTTCCG
MFN2	Forward primer TGCACCGCCATATAGAGGAAG	78
	Reverse primer TCTGCAGTGAACTGGCAATG
Opa1	Forward primer ACCTTGCCAGTTTAGCTCCC	82
	Reverse primer TTGGGACCTGCAGTGAAGAA
Mitochondrial biogenesis genes
PGC1α	Forward primer GCAGTCGCAACATGCTCAAG	83
	Reverse primer GGGAACCCTTGGGGTCATTT
Nrf1	Forward primer AGAAACGGAAACGGCCTCAT	96
	Reverse primer CATCCAACGTGGCTCTGAGT
Nrf2	Forward primer ATGGAGCAAGTTTGGCAGGA	96
	Reverse primer GCTGGGAACAGCGGTAGTAT
TFAM	Forward primer TCCACAGAACAGCTACCCAA	84
	Reverse primer CCACAGGGCTGCAATTTTCC
Synaptic genes
Synaptophysin	Forward primer CTGCGTTAAAGGGGGCACTA	81
	Reverse primer ACAGCCACGGTGACAAAGAA
PSD95	Forward primer CTTCATCCTTGCTGGGGGTC	90
	Reverse primer TTGCGGAGGTCAACACCATT
Housekeeping genes
Beta Actin	Forward primer AGAAGCTGTGCTATGTTGCTCTA	91
	Reverse primer TCAGGCAGCTCATAGCTCTTC
GAPDH	Forward primer TTCCCGTTCAGCTCTGGG	59
	Reverse primer CCCTGCATCCACTGGTGC

The mRNA transcript level was normalized against β-actin and the GAPDH at each of # dilutions. The standard curve was the normalized mRNA transcript level, plotted against the log-value of the input cDNA concentration at each dilution. To compare β-actin, GAPDH and neuroprotective markers, relative quantification was performed according to the (CT) method (Applied Biosystems). Briefly, the CT method involved averaging triplicate samples, which were taken as the CT values for β-actin, GAPDH, and mitochondrial and synaptic genes. β-Actin normalization was used for determining mitochondrial dynamics, biogenesis and the synaptic genes because the β-actin CT values were similar for the SS31-treated mice and the untreated APP mice. The ΔCT-value was obtained by subtracting the average β-actin CT value from the average CT value of the synaptic mitochondrial genes and the mitochondrial structural genes. The ΔCT of the untreated mice was used as the calibrator. Fold change was calculated according to the formula 2^−nΔΔCT), where ΔΔCT is the difference between ΔCT and the ΔCT calibrator value. To determine the statistical significance of mRNA expression, the CT value differences between the untreated APP mice and other lines of mice were used in relation to β-actin normalization. Statistical significance was calculated, using one-way ANOVA.

Immunoblotting analysis

To determine SS31 alters the protein levels of mitochondrial dynamics and the biogenesis of synaptic genes (those that showed altered mRNA expression, we performed immunoblotting analyses of protein lysates from the SS31-treated APP mice and the untreated APP mice, as described in Manczak and Reddy (67). Twenty microgram protein lysates from cortical and hippocampal tissues of the SS31-treated and untreated mice were resolved on a 4-12% Nu-PAGE gel (Invitrogen). The resolved proteins were transferred to nylon membranes (Novax Inc., San Diego, CA, USA) and incubated for 1 h at room temperature with a blocking buffer (5% dry milk dissolved in a TBST buffer). The PVDF membranes were incubated overnight with the primary antibodies shown in Table 3. The membranes were washed with a TBST buffer three times at 10-min intervals and were then incubated for 2 h with appropriate secondary antibodies, followed by three additional washes at 10-min intervals. Mitochondrial and synaptic proteins were detected with chemiluminescence reagents (Pierce Biotechnology, Rockford, IL, USA), and the bands from immunoblots were quantified on a Kodak Scanner (ID Image Analysis Software (Kodak Digital Science, Kennesaw, GA, USA). Briefly, image analysis was used to analyze gel images captured with a Kodak Digital Science CD camera. The lanes were marked to define the positions and specific regions of the bands. An ID fine-band command was used to locate and to scan the bands in each lane and to record the readings.

Table 3.

Summary of antibody dilutions and conditions used in immunoblotting analysis of mitochondrial dynamics, mitochondrial biogenesis, and synaptic proteins in 12-month-old SS31-treated and untreated APP mice

Marker	Primary antibody – species and dilution	Purchased from company, city & state	Secondary antibody, dilution	Purchased from company, city & state
Drp1	Rabbit polyclonal 1:500	Novus Biological, Littleton, CO	Donkey Anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
Mfn1	Rabbit polyclonal 1:400	Novus Biological, Littleton, CO	Donkey Anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
Mfn2	Rabbit polyclonal 1:400	Abcam, Cambridge, MA	Donkey Anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
SYN	Rabbit monoclonal 1:400	Abcam, Cambridge, MA	Donkey Anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
PSD95	Rabbit monoclonal 1:300	Abcam, Cambridge, MA	Donkey Anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
PGC1α	Rabbit polyclonal 1:500	Novus Biological, Littleton, CO	Donkey Anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
Nrf1	Rabbit polyclonal 1:300	Santa Cruz Biotechnology, Inc., Dallas, TX	Donkey Anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
Nrf2	Rabbit polyclonal 1:300	Novus Biological, Littleton, CO	Donkey Anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
TFAM	Rabbit polyclonal 1:300	Novus Biological, Littleton, CO	Donkey Anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
6E10	Mouse monoclonal 1:500	BioLegend San Diego, CA	Sheep Anti-mouse HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
B-actin	Mouse monoclonal 1:500	Sigma–Aldrich, St Luis, MO	Sheep Anti-mouse HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ

Immunofluorescence analysis and quantification

Immunofluorescence analysis was performed using midbrain sections from the SS31-treated APP mice and the untreated APP mice, as described in Manczak and Reddy (67). Immunofluorescence analysis was performed for Drp1, Mfn1, Mfn2, PGC1α, Nrf1, Nrf2, TFAM, synaptophysin, PSD95 and mutant APP/Aβ deposits. The sections were washed with warm PBS, fixed in freshly prepared 4% paraformaldehyde in PBS for 10 min, and then washed with PBS and permeabilized with 0.1% Triton-X100 in PBS. They were blocked with a 1% blocking solution (Invitrogen) for 1 h at room temperature. All sections were incubated overnight with primary antibodies (see Table 4). After incubation, the sections were washed three times with PBS, for 10 min each. The sections were incubated with a secondary antibody conjugated with Fluors 488 and 599 (Invitrogen) for 1 h at room temperature. The sections were washed three times with PBS and mounted on slides. Photographs were taken with a multiphoton laser scanning microscope system (Zeiss Meta LSM510). To quantify the immunoreactivity of mitochondrial and synaptic antibodies for each treatment, 10–15 photographs were taken at ×40 magnification. Statistical significance was assessed, using a one-way ANOVA for mitochondrial and synaptic and mitochondrial proteins.

Table 4.

Summary of antibody dilutions and conditions used in the immunofluorescence analysis of mitochondrial dynamics, mitochondrial biogenesis, and synaptic proteins in 12-month-old SS31-treated and untreated APP mice

Marker	Primary antibody—species and dilution	Purchased from company, city & state	Secondary antibody, dilution Alexa Fluor dye	Purchased from company, city & state
Drp1	Rabbit polyclonal 1:300	Novus Biological, Littleton, CO	Donkey Anti-rabbit IgG Alexa Fluor 488 Conjugate	Thermo Fisher Scientific, Waltham, MA
Mfn1	Rabbit polyclonal 1:300	Protein Tech Group, Inc., Chicago, IL	Donkey Anti-rabbit IgG Alexa Fluor 488 Conjugate	Thermo Fisher Scientific, Waltham, MA
Mfn2	Rabbit polyclonal 1:200	Protein Tech Group, Inc., Chicago, IL	Donkey Anti-rabbit IgG Alexa Fluor 488 Conjugate	Thermo Fisher Scientific, Waltham, MA
PGC1α	Rabbit polyclonal 1:300	Novus Biological, Littleton, CO	Donkey Anti-rabbit IgG Alexa Fluor 488 Conjugate	Thermo Fisher Scientific, Waltham, MA
Nrf1	Rabbit polyclonal 1:200	Santa Cruz Biotechnology, Inc., Dallas, TX	Donkey Anti-rabbit IgG Alexa Fluor 488 Conjugate	Thermo Fisher Scientific, Waltham, MA
Nrf2	Rabbit polyclonal 1:300	Novus Biological, Littleton, CO	Donkey Anti-rabbit IgG Alexa Fluor 488 Conjugate	Thermo Fisher Scientific, Waltham, MA
TFAM	Rabbit polyclonal 1:300	Novus Biological, Littleton, CO	Donkey Anti-rabbit IgG Alexa Fluor 488 Conjugate	Thermo Fisher Scientific, Waltham, MA
SYN	Rabbit polyclonal 1:400	Protein Tech Group, Inc., Chicago, IL	Donkey Anti-rabbit IgG Alexa Fluor 488 Conjugate	Thermo Fisher Scientific, Waltham, MA
PSD95	Rabbit polyclonal 1:400	Protein Tech Group, Inc., Chicago, IL	Donkey Anti-rabbit IgG Alexa Fluor 488 Conjugate	Thermo Fisher Scientific, Waltham, MA
6E10	Mouse monoclonal 1:400	Biolegend, San Diego, CA	Donkey Anti-mouse IgG Alexa Fluor 594 Conjugate	Thermo Fisher Scientific, Waltham, MA

Measurement of soluble Aβ levels

The cerebral cortex of each APP mouse brain was snap-frozen on dry ice at the time of sacrifice and stored at −70 °C until a homogenate was prepared. Briefly, protein cortical and hippocampal tissues from all groups of mice were homogenized in a tris-buffered saline (pH 8.0) containing protease inhibitors (20 mg/ml pepstatin A, aprotinin, phosphoramidon and leupeptin; 0.5 mm phenylmethanesulfonyl fluoride; and 1 mm ethyleneglycol-bis(flaminoethyl ether)-NN tetra-acetic acid). Samples were briefly sonicated and centrifuged at 10 000g for 20 min at 4 °C. The soluble fraction was used to determine the soluble Aβ by ELISA. For each sample, Aβ1-40 and Aβ1-42 were measured with commercial colorimetric ELISA kits (Biosource International, Camarillo, CA, USA) specific for each species. A 96-well plate reader was used, following the manufacturer's instructions. Each sample was run in duplicate. Protein concentrations of the homogenates were determined following the BSA method, and Aβ was expressed as pg Aβ/mg protein.

Mitochondrial functional assays

H₂O₂ production. Using an Amplex^® Red H₂O₂ Assay Kit (Molecular Probes, Eugene, OR, USA), the production of H₂O₂ was measured using cortical tissues from the SS31-treated APP mice and the untreated mice, as described in Manczak and Reddy (67). Briefly, H₂O₂ production was measured in the mitochondria cortical tissues from all lines of mice. A BCA Protein Assay Kit (Pierce Biotechnology) was used to estimate protein concentration. The reaction mixture contained mitochondrial proteins (μg/μl), amplex red reagents (50 μM), horseradish peroxidase (0.1 U/ml), and a reaction buffer (1×). The mixture was incubated at room temperature for 30 min, followed by spectrophotometer readings of fluorescence (570 nm). H₂O₂ production was finally determined, using a standard curve equation expressed in nmol/μg mitochondrial protein. H₂O₂ levels were compared between the SS31-treated and untreated APP mice.

Lipid peroxidation assay. Lipid peroxidates are unstable indicators of oxidative stress in the brain. The final product of lipid peroxidation is HNE. We measured HNE in cell lysates prepared from cortical tissues taken from the SS31-treated and untreated APP mice. We used an HNE-His ELISA Kit in order to measure HNE levels (Cell BioLabs, Inc., San Diego, CA, USA), as described in Manczak and Reddy (67). Briefly, freshly prepared protein was added to a 96-well protein binding plate and incubated overnight at 4 °C. It was then washed three times with a buffer. After the last wash, the anti-HNE-His antibody was added to the protein in the wells, was then incubated for 2 h at room temperature, and again was washed three times. The samples were then incubated with a secondary antibody conjugated with peroxidase for 2 h at room temperature, followed by incubation with an enzyme substrate. Optical density was measured at 450 nm to quantify the level of HNE. Lipid peroxidation levels were compared between the SS31-treated and untreated APP mice.

Cytochrome C oxidase activity (COX). COX was measured in cortical tissues from all lines of mice. Enzyme activity was assayed spectrophotometrically, using a Sigma Kit (Sigma–Aldrich, St. Louis, MO, USA) following manufacturer’s instructions. Briefly, 2 μg protein lysate was added to 1.1 ml of a reaction solution containing 50 μl of 0.22 mm ferricytochrome c fully reduced by sodium hydrosulphide, Tris–HCl (pH 7.0), and 120 mm potassium chloride. The decrease in absorbance at 550 mm was recorded for 1-min reactions at 10-s intervals. COX was measured according to the following formula: mU/mg total mitochondrial protein = (A/min sample − (A/min blank) × 1.1 mg protein × 21.84). Protein concentrations were determined following the BCA method. COX levels were compared between the SS31-treated and untreated APP mice.

ATP levels. ATP levels were measured in mitochondria isolated from cortical tissues of the SS31-treated and untreated APP mice, using an ATP determination kit (Molecular Probes). The bioluminescence assay was based on the reaction of ATP with recombinant firefly luciferase and its subtract luciferin. Luciferase catalyzes the formation of light from ATP and luciferin. It is the emitted light that is linearly related to the concentration of ATP, which is measured with a luminometer. In the current study, ATP levels were measured from mitochondrial pellets using a standard curve method. The ATP levels were also compared between the SS31-treated and untreated APP mice.