Table 1.
Selected shRNA and Target Sequences
| shRNA | Target Sequence (Mouse) | Remarks | Top 3 of Potential Off-Target mRNA (Mouse) | Sequence Homology (%) |
|---|---|---|---|---|
| shRNA ctrl | GGGCTATCCCAACGCTATTAGT | no target | UTP23 small subunit processome component (Utp23) | 68 |
| Von Willebrand factor A domain containing 2 (Vwa2) | 63 | |||
| B cell CLL/lymphoma 11A (zinc finger protein) (Bcl11a) | 59 | |||
| shDnm2 A | AACCGCGGGATGGAAGAGCT | identical to human sequence | transmembrane protein 67 (Tmem67) | 70 |
| family with sequence similarity 206, member A (Fam206a) | 70 | |||
| protein phosphatase 1F (PP2C domain containing) (Ppm1f) | 70 | |||
| shDnm2 B | AACTTGACCCTCATCGACCTC | identical to human sequence | potassium voltage-gated channel, subfamily G, member 1 (Kcng1) | 76 |
| IKAROS family zinc finger 1 (Ikzf1) | 76 | |||
| DnaJ heat shock protein family (Hsp40) member C2 (Dnajc2) | 71 | |||
| shDnm2 C | AAGGACATGATCCTGCAGTTCAT | identical to human sequence | adaptor-related protein complex 3, delta 1 subunit (Ap3d1) | 78 |
| suppressor of glucose, autophagy-associated 1 (Soga1) | 65 | |||
| adhesion G protein-coupled receptor G2 (Adgrg2) | 60 | |||
| shDnm2 D | TCGGTGTCATCACCAAGCT | identical to human sequence | myosin IA (Myo1a) | 78 |
| ankyrin repeat domain 52 (Ankrd52) | 73 | |||
| zinc finger protein 407 (Zfp407) | 73 | |||
| shDnm2 E | TGCCAACTGTTTCTATACT | 1 nucleotide different to human (underlined) | protocadherin 17 (Pcdh17) | 73 |
| folliculin interacting protein 1 (Fnip1) | 73 | |||
| zeta-chain (TCR)-associated protein kinase (Zap70) | 73 | |||
| shDnm2 F | AACTGTTTCTATACTGAGGAG | 2 nucleotides different to human (underlined) | protocadherin 17 (Pcdh17) | 71 |
| tenascin R (Tnr) | 71 | |||
| ligand-dependent nuclear receptor corepressor-like (Lcorl) | 66 | |||
| shDnm2 G | TTTCTATACTGAGGAGCTGGT | 2 nucleotides different to human (underlined) | WNK lysine-deficient protein kinase 2 (Wnk2) | 71 |
| TRAF3 interacting protein 2 (Traf3ip2) | 66 | |||
| trans-2,3-enoyl-CoA reductase-like (Tecrl) | 66 | |||
| shDnm2 H | GCACGCAGCTGAACAAGAA | identical to human sequence | HGF-regulated tyrosine kinase substrate (Hgs) | 78 |
| two-pore segment channel 2 (Tpcn2) | 73 | |||
| interleukin-1 alpha (Il1a) | 73 | |||
| shDnm2 I | AAGAAGTACATGCTGCCACTGGA | 1 nucleotide different to human (underlined) | zinc finger, C3H1-type containing (Zfc3h1) | 69 |
| DENN/MADD domain containing 5A (Dennd5a) | 69 | |||
| small G protein signaling modulator 1 (Sgsm1) | 65 | |||
| shDnm2 J | AACACCTTCTCCATGGACCC | identical to human sequence | proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 (Psmd12) | 75 |
| GTP cyclohydrolase 1 (Gch1) | 75 | |||
| acyl-CoA synthetase medium-chain family member 3 (Acsm3) | 70 | |||
| shDnm2 K | CCATTATCCGCCCAGCCGAGC | identical to human sequence | poly (ADP-ribose) polymerase family, member 6 (Parp6) | 66 |
| RAP2B, member of RAS oncogene family (Rap2b) | 66 | |||
| arylsulfatase i (Arsi) | 66 |
CoA, coenzyme A.