Table 1. Primers and probes used in this study.
| Gene name | Primers or probes 5´-3´ | Probe number | GenBank accession number |
|---|---|---|---|
| Granzyme A | F ggccatctcttgctactctcc | 75* | NM_010370.2 |
| R cgtgtctcctccaatgattct | |||
| Granzyme B | F gctgctcactgtgaaggaagt | 2* | NM_013542.2 |
| R tggggaatgcattttaccat | |||
| Perforin 1 | F gaagaagaaacagcacaaaatgg | 31* | NM_011073.3 |
| R gacgtgacgctcacggtag | |||
| Interferon-γ | F cagcaacagcaaggcgaa | - | NM_008337.1 |
| R cggatgagctcattgaatgct | |||
| P ttgccaagtttgaggtcaacaaccca | |||
| Glyceraldehyde 3-phosphate dehydrogenase | F ggtgtcttcaccaccatgga | - | NM_008084.2 |
| (GAPDH) | R cagaaggggcggagatgat | ||
| P aaggccggggcccacttgaa | |||
*Listed probe numbers indicate the product number of the Universal ProbeLibrary Set (Human and Extension Set) sold by Roche Applied Science.
Primers and probes of IFN-g and GAPDH were designed and synthesized by Bioresearch Technologies Japan (Tokyo, Japan).