Skip to main content
. 2018 Mar 28;37(3):49–57. doi: 10.12938/bmfh.17-021

Table 1. Primers and probes used in this study.

Gene name Primers or probes 5´-3´ Probe number GenBank accession number
Granzyme A F ggccatctcttgctactctcc 75* NM_010370.2
R cgtgtctcctccaatgattct

Granzyme B F gctgctcactgtgaaggaagt 2* NM_013542.2
R tggggaatgcattttaccat

Perforin 1 F gaagaagaaacagcacaaaatgg 31* NM_011073.3
R gacgtgacgctcacggtag

Interferon-γ F cagcaacagcaaggcgaa - NM_008337.1
R cggatgagctcattgaatgct
P ttgccaagtttgaggtcaacaaccca

Glyceraldehyde 3-phosphate dehydrogenase F ggtgtcttcaccaccatgga - NM_008084.2
(GAPDH) R cagaaggggcggagatgat
P aaggccggggcccacttgaa

*Listed probe numbers indicate the product number of the Universal ProbeLibrary Set (Human and Extension Set) sold by Roche Applied Science.

Primers and probes of IFN-g and GAPDH were designed and synthesized by Bioresearch Technologies Japan (Tokyo, Japan).