Table 1.

Primer sequences for PCR, fragment analysis and Sanger sequencing

c.35delG and studied markers (localization, GRCh38.p12)a	Primer sequences	Methods of detection
c.35delG (GJB2) (13:20189547)	F: 5′-GGTGAGGTTGTGTAAGAGTTGG-3′ R: 5’-CTGGTGGAGTGTTTGTTCC*CAC-3’	PCR-mediated site-directed mutagenesis (PSDM) with use of Bsc4 I
D13S141b (13:20150320–20,150,445)	F: 5’-GTCCTCCCGGCCTAGTCTTA-3’ (6-FAM) R: 5’-ACCACGGAGCAAAGAACAGA-3’	Fragment analysis (GeneScan 500 LIZ) on ABI 3130XL (Applied Biosystems)
D13S175b (13:20274367–20,274,479)	F: 5’-TATTGGATACTTGAATCTGCTG-3’ (PET) R: 5’-TGCATCACCTCACATAGGTTA-3’
D13S1853b (13:20466607–20,466,800)	F: 5’- CAGACTGGCACAAACTTAACTG −3’ (6-FAM) R: 5’- TGTACATCTCTTCTTACATTCATGT − 3’
rs3751385 (13:20188817)	F: 5’-GGCTGGTGAAGTGCAACG-3′ R: 5’-GTAAGCAAACAAACTTTTGAAGTAG-3’	PCR-RFLP analysis with use of Nhe I

^aLocalization was taken from the Ensembl Genome browser [53]; ^b - Specific primer sequences for PCR amplification of microsatellites D13S141, D13S175, and D13S1853 were obtained from the Ensembl genome browser and the NCBI Probe Database [53, 54], one from each primer pairs was labeled with the fluorescent dyes