Table 1.

PCR primers used for the expression analysis and the preparation of the templates for the cRNA probes used in in situ hybridization

Target cDNA	Upstream primer	Downstream primer	Region	Genbank acc. no.	aa. identitiy (%) to Deroceras gene
FMRFamide	agacgataagctccaccgctttg	tcttcagcctgaacgtatgacgc	83–300 (2–219)	AB546959 (AB546960)	79.1
LFRFamide1	atgatcaagagtcagctctcag	atcgctgtcactaccccagtg	15–563	LC375313	83.1
LFRFamide2	cgactctgataaaaggggctcc	atgtgactactgggaacgccag	566–1021	LC375314	70.6
CCK/SK1	cgctgcccacactgaacaag	ggtttcattgttgttggcgaag	743–1111	LC375319	73.5
CCK/SK2	agagcacaccactgaaggac	tcggatgtgtcggggttta	451–912	LC375320	82.4
NP-F1	gttgctctaataatttgctcgggag	gccgccatgtttgttagttgac	303–782	LC375315	91.7
NP-F2	caacacactacgcccacacag	ctgttcacgagtgtgctcgag	972–1520	LC375316	92.9
pedal peptide	atagaatcgctggtgcgtcgag	cgccgttatcgctgagttcatg	4219–4716	LC375323	–
FaRP-A	tgacgagctcgatacgacctatg	cctcgtggtcaaaccttctgaac	399–967	LC375321	–
FaRP-B	agaccagcgtgcgcaccag	ctgggccagcagacattgac	144–650	LC375322	–
luqin1	ccacccttaagtcagcaactc	ggaatagaaacacaggagagcgatg	401–1051	LC375317	88.7
luqin2	ctcttgtctcatctgcccacac	agctatccgaaccgtgtgagtc	19–552	LC375318	65.4
18S rRNA	gcttaccaagctccgaccctcgtgg	cgtcactacctccccgtgccggg	62–383	LC375324	–

The accession numbers of the Limax RFamide cDNAs and the amino acid identities of precursors to the corresponding Deroceras homologues are shown in the right columns. The numerals in the “region” column indicate the amplified cDNA regions in the sequence data deposited in Genbank. The information for the splice variant of FMRFamide (FMRFamide Type II) is shown in parentheses