Abstract
The WNT signaling pathway is commonly altered during colorectal cancer development. The E3 ubiquitin ligase, RNF43, negatively regulates the WNT signal through increased ubiquitination and subsequent degradation of the Frizzled receptor. RNF43 has recently been reported to harbor frequent truncating frameshift mutations in sporadic microsatellite unstable (MSI) colorectal cancers. This study assesses the relative frequency of RNF43 mutations in hereditary colorectal cancers arising in the setting of Lynch syndrome. The entire coding region of RNF43 was Sanger sequenced in 24 colorectal cancers from 23 patients who either (i) carried a germline mutation in one of the DNA mismatch repair genes (MLH1, MSH6, MSH2, PMS2), or (ii) showed immunohistochemical loss of expression of one or more of the DNA mismatch repair proteins, was BRAF wild type at V600E, were under 60 years of age at diagnosis, and demonstrated no promoter region methylation for MLH1 in tumor DNA. A validation cohort of 44 colorectal cancers from mismatch repair germline mutation carriers from the Australasian Colorectal Cancer Family Registry (ACCFR) were sequenced for the most common truncating mutation hotspots (X117 and X659). RNF43 mutations were found in 9 of 24 (37.5%) Lynch syndrome colorectal cancers. The majority of mutations were frameshift deletions in the G659 G7 repeat tract (29%); 2 cancers (2/24, 8%) from the one patient harbored frameshift mutations at codon R117 (C6 repeat tract) within exon 3. In the ACCFR validation cohort, RNF43 hotspot mutations were identified in 19/44 (43.2%) of samples, which was not significantly different to the initial series. The proportion of mutant RNF43 in Lynch syndrome related colorectal cancers is significantly lower than the previously reported mutation rate found in sporadic MSI colorectal cancers. These findings identify further genetic differences between sporadic and hereditary colorectal cancers. This may be because Lynch Syndrome cancers commonly arise in colorectal adenomas already bearing the APC mutation, whereas sporadic microsatellite unstable colorectal cancers arise from serrated polyps typically lacking APC mutation, decreasing the selection pressure on other WNT signaling related loci in Lynch syndrome.
Keywords: RNF43, Lynch syndrome, MSI, Microsatellite instability, Colorectal cancer, HNPCC
Introduction
The WNT signaling pathway is frequently altered during colorectal carcinogenesis [1]. The E3 ubiquitin ligase, RNF43, acts as a negative regulator of the WNT pathway by inducing ubiquitin-mediated endocytosis of cell surface Frizzled receptors [2]. Recently, RNF43 has been proposed as a key mutational target of microsatellite unstable (MSI) sporadic colorectal cancers [1, 3, 4].
Microsatellite instability refers to the high frequency of mutations within microsatellite (repetitive) regions of the genome [5], which develops as a result of impairment of a DNA mismatch repair gene [6]. Mutations driven by MSI occur most frequently in non-coding genomic regions but may also target coding repeat tracts in key tumor suppressor genes. Such mutations in key tumor suppressor genes including TGFRBII [7] contribute to tumor progression.
Lynch syndrome is the most common cause of hereditary colorectal cancer resulting from germline mutations in one of the DNA mismatch repair genes, predominantly in MLH1 or MSH2, but also in the binding partners MSH6 and PMS2 [8].
Recent studies have shown that microsatellite instability arising in a sporadic setting is significantly associated with somatic mutation of the RNF43 gene [3, 4, 9]. RNF43 is a ubiquitin ligase that dampens the WNT signal. It achieves this through ubiquitination, inducing the endocytosis and subsequent degradation of the Frizzled receptor on the cell surface [2]. Inhibition of RNF43 has been implicated in the increase in expression of Frizzled receptors on the cell membrane and resultant increased WNT signal. In sporadic MSI colorectal cancer, frameshift events have been shown to occur in repeat tracks of RNF43, primarily a single nucleotide deletion in the G7 repeat tract occurring in codon 659 within exon 9 [3]. We have previously identified a high rate of G7 repeat tract mutations (87%) in sporadic MSI colorectal cancers [3] compared with only 4% in microsatellite stable colorectal cancers [3].
In this study, we assessed the frequency of somatic mutational events within RNF43 in two cohorts of Lynch syndrome colorectal cancers and compared this with previously reported RNF43 somatic mutation frequency from sporadic MSI colorectal cancers.
Methods
Patient samples
The discovery cohort was comprised of 24 Lynch syndrome related colorectal cancer samples collected from patients at the time of surgical resection at the Royal Brisbane and Women’s Hospital, Australia. Tumor samples were snap-frozen in liquid nitrogen and DNA was extracted using salt precipitation [10]. The validation cohort was comprised of 44 colorectal cancers from germline mismatch repair gene mutation carriers recruited to the Australasian Colorectal Cancer Family Registry (ACCFR). Details of ACCFR recruitment, tumor collection and mutation testing have been described in detail previously (Newcomb et al. 2007 CEBP) and are available at http://coloncfr.org. The study protocol was approved by the Human Research Ethics Committees of the Royal Brisbane and Women’s Hospital, QIMR Berghofer Medical Research Institute and the University of Melbourne.
Sample selection
Cancers were included in this study if they met the following criteria: (i) carriers of a germline mutation in one of the DNA mismatch repair genes (MLH1, MSH6, MSH2, PMS2), or (ii) showed immunohistochemical loss of expression of one or more of the four DNA mismatch repair proteins, was BRAF wild type at V600E, patient age <60 years at colorectal cancer diagnosis, demonstrated no promoter region methylation for MLH1 in tumor DNA, and were determined to have MSI. This was assessed using the National Cancer Institute’s 5 marker panel [5] where MSI was classified if at least one mononucleotide and at least one other marker was positive [11].
Sequence analysis
Tumor DNA was amplified by PCR (See Table 1 for primer sequences). The primers were designed using Primer3 BLAST in conjunction with sequence data obtained from the CHIP SNPPER [12] online tool. Separate primers were designed for the ACCFR validation cohort to flank only the exon 3 and 9 hotspot (Table 1). PCR conditions are available on request. The PCR products were then treated with the ExoSapIT (Affymetrix, OH, USA) reagent as per the manufacturer’s protocol and sequenced on an ABI3100 Capillary sequencer (Applied Biosystems, USA) (Table 1).
Table 1.
Primers used for polymerase chain reaction and sanger sequencing (5’–3’)
| Exon | Forward primer sequence 5’–3’ | Reverse primer sequence 5’–3’ |
|---|---|---|
| 2 | GAGAAAGGAAGGGCCAAAAA | GAGAAAGGAAGGGCCAAAAA |
| 3 | CCAGCATCCTGAAGTGACAA | GGAAACATGGGGACAAGAGA |
| 4 | TTAGACCCAGTGACCCCTTG | TCAGCGTCATTACCCCAGAT |
| 5 | CATCACTGAGGATCGAGCTG | TGTAGGTGAGGCCCAAAGAC |
| 6 | TAATCCCACTTGCAGGTTCC | ACAGACGCTGGGGTATTTTG |
| 7 | TGAGTGACTGGGAACGGAGT | CAGGACACATGGGAAACAGA |
| 8 | TGATGCCAAAGCTCATACCA | GTGGCAGTTCTGCTTTCTCC |
| 9A | CCAGAGCACAGGCAGCTTAG | GGGTGCTGTGAGGTGGATTG |
| 9B | CTGGTCCCTTCCTGCCATC | GGTCACACTAGGCTGCATGT |
| 9C | ACTCTGTGGTCAACTGCACG | CACTGTGGGTTAGAGAGCCG |
| 9D | CCTATTCCTCGGACACAGCC | AACTCCATTCAGAAGGCCCC |
| 9E | CTGCTACCAGAAACCCCAGG | GATACGCTGTCCCGATGGTT |
| R117 | AGGTATATGGCTCTCACAGCTCACT | GGTGAAGCTCCGGGTGTGTGTA |
| X659 | CCAGTACCAGCAGTCTGTTCAACTT | TGGGGACCAAGGATATGCCACACT |
Software and statistical analysis
Statistical analysis was performed using GraphPad Prism 7 with a student’s t test used for categorical data analysis. P values of <0.05 were considered statistically significant.
Results
Clinical and molecular features of Cohort
The discovery cohort (Brisbane cohort) consisted of 10 female and 14 male colorectal cancer-affected patients. The mean age of colorectal cancer diagnosis for patients was 48.40 ± 11.52 years. DNA mismatch repair immunohistochemistry results were available for 14 tumors. Loss of immunohistochemical staining was most frequently observed for the MLH1 (6/14, 43%) and MSH2 (5/14, 36%) proteins. Fifteen samples had a documented germline mismatch repair mutation. No tumors had a BRAFV600E mutation, whilst all tumors were microsatellite unstable (Table 2). The ACCFR validation cohort was comprised of colorectal cancers from 18 female and 26 male participants confirmed to carry a germline DNA mismatch repair gene mutation. The mean age of colorectal cancer diagnosis was 50.1 ± 12.26 years. DNA mismatch repair immunohistochemistry results were available for all patients in the cohort. The most common germline defects were in the MLH1 (18/44, 41%), and MSH2 (17/44, 39%) genes (Table 3). All patients in the validation cohort were wild-type at BRAFV600E.
Table 2.
Clinicopathological data from the Brisbane cohort
| Sample | Age | Gender | Site | IHC | Germline mutation | MSI | MLH1 methylation | RNF43 mutation |
|---|---|---|---|---|---|---|---|---|
| 1 | 40.6 | Male | Rectum | NA1 | Confirmed | High | Negative | Wild-type |
| 2 | 44.3 | Female | Rectum | NA1 | Confirmed | High | Negative | X659 |
| 3 | 59 | Female | Proximal | NA1 | Confirmed | High | Negative | X117 |
| 4 | 59 | Female | Proximal | NA1 | Confirmed | High | Negative | X117 |
| 5 | 50.6 | Male | NAa | MSH2 | Confirmed | High | Negative | Wild-type |
| 6 | 59.3 | Male | Rectum | MLH1 | NAa | High | Negative | X659 |
| 7 | 65.1 | Female | Proximal | MSH6 | NAa | High | Negative | X659 |
| 8 | 54.4 | Male | Distal | MLH1 | NAa | High | Negative | Wild-type |
| 9 | 31.7 | Female | Proximal colon | MSH2 | Confirmed | High | Negative | Wild-type |
| 10 | 34.8 | Female | NAa | NA1 | Confirmed | High | Negative | Wild-type |
| 11 | 33.3 | Male | Proximal | MLH1 | Confirmed | High | Negative | Wild-type |
| 12 | 39.9 | Male | Proximal | MLH1 | Confirmed | High | Negative | X659 |
| 13 | 50.0 | Male | Proximal | MSH2 | NAa | High | Negative | Wild-type |
| 14 | 51.9 | Male | Proximal | MLH1 | NAa | High | NAa | Wild-type |
| 15 | 43.8 | Male | Distal | MLH1 | Confirmed | High | Negative | Wild-type |
| 16 | 63.2 | Male | NAa | PMS2 | Confirmed | High | Negative | Wild-type |
| 17 | 62.1 | Female | Proximal | MSH2 | Confirmed | High | Negative | X659 |
| 18 | 25.0 | Female | NAa | PMS2 | Confirmed | High | Negative | Wild-type |
| 19 | 58.5 | Male | Proximal | NA | NAa | High | NAa | Wild-type |
| 20 | 55.5 | Male | NAa | NA1 | NAa | High | Negative | Wild-type |
| 21 | 60.3 | Female | NAa | MSH2 | Confirmed | High | Negative | Wild-type |
| 22 | 38.8 | Male | Rectum | NA1 | NAa | High | Negative | Wild-type |
| 23 | 43.8 | Male | Rectum | NA1 | NAa | High | Negative | X659 |
| 24 | 36.1 | Female | Proximal | NA1 | Confirmed | High | Negative | X659 |
NA data was not available at time of publication
Table 3.
Clinicopathological data from the Australasian colorectal cancer family register cohort
| Sample ID | Age | Gender | IHC summary | MSI | Germline defect | RNF43 exon 3 (C6) | RNF43 exon 9 (G7) | RNF43 mutation |
|---|---|---|---|---|---|---|---|---|
| 1 | 72.0 | Female | MLH1/PMS2 | High | MLH1 | Wild-type | X659 | Positive |
| 2 | 32.2 | Male | MLH1/PMS2 | High | MLH1 | Wild-type | Wild-type | Wild-type |
| 3 | 34.3 | Male | MSH2/MSH6 | High | MSH2 | Wild-type | X659 | Positive |
| 4 | 49.1 | Male | MSH2/MSH6 | High | MSH2 | Wild-type | Wild-type | Wild-type |
| 5 | 80.1 | Female | PMS2 | High | PMS2 | Wild-type | Wild-type | Wild-type |
| 6 | 52.3 | Male | MLH1/PMS2 | High | MLH1 | Wild-type | X659 | Positive |
| 7 | 60.9 | Female | MLH1/PMS2 | High | MLH1 | Wild-type | X659 | Positive |
| 8 | 64.1 | Male | MSH6 | High | MSH6 | Wild-type | X659 | Positive |
| 9 | 30.9 | Female | MLH1/PMS2 | High | MLH1 | Wild-type | Wild-type | Wild-type |
| 10 | 55.1 | Male | MSH2/MSH6 | High | MSH2 | Wild-type | X659 | Positive |
| 11 | 53.5 | Male | MLH1/PMS2 | High | MLH1 | Wild-type | Wild-type | Wild-type |
| 12 | 32.3 | Male | MLH1/PMS2 | High | MLH1 | Wild-type | Wild-type | Wild-type |
| 13 | 51.9 | Female | MSH2/MSH6 | High | MSH2 | X117 | Wild-type | Positive |
| 14 | 28.7 | Male | MLH1/PMS2 | High | MLH1 | Wild-type | Wild-type | Wild-type |
| 15 | 32.9 | Female | MSH2/MSH6 | High | MSH2 | Wild-type | X659 | Positive |
| 16 | 37.2 | Male | MLH1/PMS2 | High | MLH1 | Wild-type | X659 | Positive |
| 17 | 52.0 | Female | MSH6 | High | MSH6 | Wild-type | Wild-type | Wild-type |
| 18 | 45.6 | Male | MSH2/MSH6 | High | MSH2 | Wild-type | Wild-type | Wild-type |
| 19 | 59.5 | Male | PMS2 | High | PMS2 | Wild-type | Wild-type | Wild-type |
| 20 | 61.8 | Female | MSH2/MSH6 | High | MSH2 | Wild-type | Wild-type | Wild-type |
| 21 | 40.0 | Female | MSH2/MSH6 | High | MSH2 | Wild-type | X659 | Positive |
| 22 | 54.8 | Male | MSH2/MSH6 | High | MSH2 | Wild-type | Wild-type | Wild-type |
| 23 | 50.3 | Female | MSH2/MSH6 | High | MSH2 | Wild-type | Wild-type | Wild-type |
| 24 | 33.3 | Female | MLH1/PMS2 | High | MLH1 | Wild-type | Wild-type | Wild-type |
| 25 | 56.1 | Female | MLH1/PMS2 | High | MLH1 | Wild-type | Wild-type | Wild-type |
| 26 | 46.0 | Male | MSH2/MSH6 | NA | MSH2 | Wild-type | Wild-type | Wild-type |
| 27 | 47.3 | Female | MLH1/PMS2 | NA | MLH1 | X117 | Wild-type | Positive |
| 28 | 49.7 | Male | PMS2 | NA | PMS2 | Wild-type | Wild-type | Wild-type |
| 29 | 33.2 | Female | MLH1/PMS2 | High | MLH1 | Wild-type | X659 | Positive |
| 30 | 59.2 | Female | MSH2/MSH6 | High | MSH2 | Wild-type | Wild-type | Wild-type |
| 31 | 64.5 | Male | MSH2/MSH6 | High | MSH2 | Wild-type | X659 | Positive |
| 32 | 52.6 | Male | MLH1/PMS2 | NA | MLH1 | Wild-type | X659 | Positive |
| 33 | 34.4 | Male | MLH1/PMS2 | High | MLH1 | Wild-type | X659 | Positive |
| 34 | 63.8 | Male | MSH6 | NA | MSH6 | Wild-type | Wild-type | Wild-type |
| 35 | 50.0 | Male | MSH2/MSH6 | High | MSH2 | Wild-type | Wild-type | Wild-type |
| 36 | 43.8 | Male | MSH2/MSH6 | High | MSH2 | Wild-type | Wild-type | Wild-type |
| 37 | 49.7 | Male | MLH1/PMS2 | High | MLH1 | Wild-type | Wild-type | Wild-type |
| 38 | 45.1 | Male | MLH1/PMS2 | High | MLH1 | Wild-type | X659 | Positive |
| 39 | 49.0 | Female | MSH2/MSH6 | High | MSH2 | Wild-type | X659 | Positive |
| 40 | 58.4 | Female | MLH1/PMS2 | High | MLH1 | X117 | Wild-type | Positive |
| 41 | 51.8 | Male | MSH6 | NA | MSH6 | Wild-type | X659 | Positive |
| 42 | 55.8 | Female | PMS2 | NA | PMS2 | Wild-type | Wild-type | Wild-type |
| 43 | 52.1 | Male | PMS2 | NA | PMS2 | Wild-type | Wild-type | Wild-type |
| 44 | 75.6 | Male | MSH2/MSH6 | NA | MSH2 | Wild-type | Wild-type | Wild-type |
Lynch syndrome colorectal cancers harbor moderate rates of RNF43 frameshift mutations
In the discovery cohort, we identified 9 (37.5%) RNF43 somatic mutations, all of which were frameshift events. Seven mutations (7/24, 29.1%) occurred at the hotspot G659 within exon 9 involving frameshift deletions of the G7 repeat tract. (Table 2; Fig. 1). The remaining two mutations (8.3%) occurred at R117 within exon 3 involving a frameshift within a C6 repeat tract. This occurred in two synchronous cancers from the same patient. In order to rule out a germline mutation we sequenced matched normal mucosal DNA, where we did not observe the R117 frameshift mutation.No sample contained more than one mutation. We sought to confirm the mutation rate of these two hotspot truncating events at X659 and X117 in a validation cohort (ACCFR Cohort) comprised of 44 colorectal cancers with confirmed germline mismatch repair gene mutations. Overall, RNF43 was mutated in 19/44 samples (43.2%) where X659 hotspot mutations were identified in 16 tumors (16/44, 36.3%), and X117 mutations in 3 samples (3/44, 6.8%) (Table 3). No instances of concurrent X117 and X659 mutations in either cohort were observed. We found no statistically significant relationship between clinical data and mutation status of RNF43. Similarly, we found no evidence of an association between the specific mismatch repair gene deficiency and RNF43 mutational frequency.
Fig. 1.
Example of RNF43 Sanger sequencing at codon G659. Left wild type RNF43 codon G659 (G7 repeat tract) exon 9 (reverse sequence); Right mutant RNF43 showing a frame shift at G659 from a one base pair deletion of G7 tract (reverse sequence). Sequence data figured from screenshot of finchTV sequence analysis software
Lynch syndrome colorectal cancers have significantly lower RNF43 mutation rates than sporadic colorectal cancers
We compared results from this study to previously obtained RNF43 mutational data from sporadic colorectal cancer patients [3, 9]. Bond et al. reported RNF43 somatic mutations in 47/54 (87.0%) sporadic MSI colorectal cancers; 43 (80%) of mutations identified were the X659 hotspot mutation and 6 (11%) were the X117 mutation [3], while Yan et al. reported truncating RNF43 mutations in 17/20 (85%) sporadic MSI colorectal cancers in the initial cohort, and 30/39 (77%) sporadic MSI colorectal cancers in the TCGA validation cohort. (Fig. 2) [9]. We compared the rate of RNF43 hotspot truncating mutations in our Lynch syndrome colorectal cancer cohorts to both Yan et al. and Bond et al. The combined hotspot mutation rate in the initial and validation cohort was significantly lower in the Lynch syndrome related colorectal cancers compared with both Bond et al. and Yan et al. (Initial cohort: p<0.0001 versus Bond et al. and p< 0.001 versus both Yan et al. cohorts; Validation cohort: p< 0.0001 versus Bond et al. and p=0.0024, p=0.034 for Yan et al. Hong Kong cohort, and TCGA cohorts, respectively). Therefore, hereditary Lynch syndrome MSI colorectal cancers harbor significantly fewer RNF43 mutations than sporadic MSI-H colorectal cancers.
Fig. 2.
Combined mutation rate (%) at hotspots X117 and X659 from Lynch syndrome cohorts and previously reported sporadic microsatellite unstable colorectal cancers [3, 9]. Asterisk Indicates significance below 0.05 versus all sporadic cohorts
Discussion
Microsatellite instability (MSI) is a key characteristic of both hereditary and sporadic mismatch repair deficient colorectal cancers. Due to previous reports of sporadic MSI cancers harboring frequent RNF43 frameshift mutations, we wanted to determine if hereditary Lynch syndrome related MSI cancers were similar in this respect. Previous literature has identified RNF43 as mutated between 70 and 80% of sporadic MSI-H colorectal cancers [3, 4], our findings show that RNF43 mutations occurred in around 40% of the Lynch syndrome related colorectal cancers, which was significantly lower than for sporadic MSI-H colorectal cancer. Our results revealed that despite the shared MSI phenotype, Lynch syndrome and sporadic MSI cancers may possess different mutational target genes. This is in line with previous research that showed a variety of factors determine which genes are targeted by MSI colorectal cancers [13]. Pinheiro et al. noted that hereditary MSI cancers mutated gene sets with a different frequency dependent on the location of the tumor. It may be that selective pressures on tumors deriving from germline or sporadic origins may drive particular targeted mutational profiles.
Data from this study is concordant with known molecular characteristics of MSI colorectal cancers. Wild type RNF43 reduces membrane surface expression of Frizzled receptors and therefore acts as a negative regulator of downstream WNT signaling. Lynch syndrome related colorectal cancer have previously been shown to activate the WNT pathway to a greater degree than sporadic MSI carcinomas [14], typically via downstream pathogenic CNNTB1 mutations, and to a lesser extent, APC mutation [15–17]. Loss of APC mutations occur in large proportions of conventional adenomas [14, 17], which are the precursor lesions to malignant Lynch syndrome colorectal cancers. In contrast, sporadic MSI colorectal cancer typically arise from the serrated polyps, which harbor high proportions of oncogenic BRAF mutations, namely BRAFV600E and lower frequencies of APC mutations. Native APC regulates the WNT signaling pathway through degradation of β-catenin by forming a co-degradation complex with GSK3 and AXIN [18]. Pathogenic APC mutations prevent the complex from degrading β-catenin efficiently which then accumulates in the cell nucleus. Loss of APC as seen in Lynch syndrome cancers could reduce deleterious selection pressures at the RNF43 locus and this is further supported by the mutational exclusivity shown between RNF43 and APC [4].
Yan and colleagues noted in organoid studies that induction of the X659 frameshift mutation resulted in a phenotype of decreased dependence on R-spondin-1 and increased WNT dependence [9]. This is in line with the previous prediction of the deleterious nature of RNF43 mutations noted by Giannakins et al. [4]. The current study adds further evidence supporting this hypothesis. The selective nature of the mutations seen between the hereditary MSI and sporadic MSI cohorts indicates the high likelihood of a biological advantage to RNF43 mutations in sporadic MSI colorectal cancer.
Inhibition of the WNT signaling pathway has proved challenging in cancer with mutated APC, however upstream inhibition of porcupine has shown some promise in a subsection of colorectal cancers. LGK974 is a small molecular inhibitor that targets Porcupine and results in a decreased WNT ligand secretion. LGK974 inhibits Porcupine and as a result reduces the level of WNT ligand secretion [19]. Reduction of WNT ligand secretion reduces Frizzled-WNT binding capacity and therefore results in a decrease in canonical WNT signaling. Inhibition of WNT ligand secretion can increase differentiation and decrease proliferation in WNT dependent cell lines [19]. Porcupine inhibitors have been shown to be exclusively effective against RNF43 mutant cell lines [3, 20]. Cancers with deficient RNF43 are unable to ubiquitinate and subsequently degrade surface Frizzled receptors thereby allowing the WNT pathway to continuously signal. As the majority of sporadic MSI colorectal cancers harbor the mutant RNF43 genotype required for sensitivity, LGK974 may be an appropriate targeted therapy for this cancer type and is currently undergoing stage I/II safety and efficacy studies [21, 22]. However, we propose that hereditary Lynch syndrome MSI colorectal cancers should not be assumed to be sensitive to LGK974 or other porcupine inhibitors based solely on their MSI status, given they display a significantly lower rate of RNF43 mutations than sporadic MSI colorectal carcinomas.
Here, we report that RNF43 is less frequently mutated in hereditary versus sporadic MSI colorectal cancers. It is possible that differences in mutation preference is a result of selective pressures acting differentially on loci in the setting of sporadic versus Lynch syndrome colorectal cancer. Further, our study indicated that hereditary MSI colorectal cancers face significantly less selective pressure for RNF43 inactivation, possibly due to pre-existing downstream mutation of other WNT pathway members, as previously reported in the literature [17]. Lastly, Porcupine inhibition may play a reduced role in Lynch syndrome colorectal cancer treatment as they have a lower mutation rate and hence are less likely to be sensitive to this therapeutic approach.
Acknowledgments
Funding RBWH Research Foundation, National Health and Medical Research Council, Pathology Queensland. Grant UM1 CA167551 from the National Cancer Institute and through cooperative agreements with Australasian Colorectal Cancer Family Registry (U01 CA074778 and U01/U24 CA097735) and was conducted under Colon-CFR approval C-AU-1014-01. Christophe Rosty is the Jass Pathology Fellow. Daniel D. Buchanan is a University of Melbourne Researcher at Melbourne Accelerator Program (R@MAP), a Senior Research Fellow and NHMRC R.D. Wright Career Development Fellow.
Footnotes
Compliance with ethical standards
Conflict of interest The authors declare that they have no conflict of interest.
References
- 1.Jo YS, Kim MS, Lee JH, Lee SH, An CH, Yoo NJ (2015) Frequent frameshift mutations in 2 mononucleotide repeats of RNF43 gene and its regional heterogeneity in gastric and colorectal cancers. Hum Pathol 46(11): 1640–1646. doi: 10.1016/j.humpath.2015.07.004 [DOI] [PubMed] [Google Scholar]
- 2.Koo BK, Spit M, Jordens I et al. (2012) Tumour suppressor RNF43 is a stem-cell E3 ligase that induces endocytosis of Wnt receptors. Nature 488(7413):665–669. doi: 10.1038/nature11308 [DOI] [PubMed] [Google Scholar]
- 3.Bond CE, McKeone DM, Kalimutho M et al. (2016) RNF43 and ZNRF3 are commonly altered in serrated pathway colorectal tumorigenesis. Oncotarget. doi: 10.18632/oncotarget.12130 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Giannakis M, Hodis E, Jasmine Mu X et al. (2014) RNF43 is frequently mutated in colorectal and endometrial cancers. Nat Genet 46(12):1264–1266. doi: 10.1038/ng.3127 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Boland CR, Thibodeau SN, Hamilton SR et al. (1998) A National Cancer Institute Workshop on Microsatellite Instability for cancer detection and familial predisposition: development of international criteria for the determination of microsatellite instability in colorectal cancer. Cancer Res 58(22):5248–5257 [PubMed] [Google Scholar]
- 6.Gatalica Z, Vranic S, Xiu J, Swensen J, Reddy S (2016) High microsatellite instability (MSI-H) colorectal carcinoma: a brief review of predictive biomarkers in the era of personalized medicine. Fam Cancer. doi: 10.1007/s10689-016-9884-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Biswas S, Trobridge P, Romero-Gallo J et al. (2008) Mutational inactivation of TGFBR2 in microsatellite unstable colon cancer arises from the cooperation of genomic instability and the clonal outgrowth of transforming growth factor beta resistant cells. Genes Chromosomes Cancer 47(2):95–106. doi: 10.1002/gcc.20511 [DOI] [PubMed] [Google Scholar]
- 8.Zhang T, Boswell EL, McCall SJ, Hsu DS (2015) Mismatch repair gone awry: management of Lynch syndrome. Crit Rev Oncol/hematol 93(3):170–179 doi: 10.1016/j.critrevonc.2014.10.005 [DOI] [PubMed] [Google Scholar]
- 9.Yan HH, Lai JC, Ho SL et al. (2016) RNF43 germline and somatic mutation in serrated neoplasia pathway and its association with BRAF mutation. Gut. doi: 10.1136/gutjnl-2016-311849 [DOI] [PubMed] [Google Scholar]
- 10.Miller SA, Dykes DD, Polesky HF (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16(3):1215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Nagasaka T, Koi M, Kloor M et al. (2008) Mutations in both KRAS and BRAF may contribute to the methylator phenotype in colon cancer. Gastroenterology 134(7):1950–1960. doi: 10.1053/j.gastro.2008.02.094 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Riva A (2011) CHIP Bioinformatics. vol. 05/11, University of Florida, CHIP Bioinformatics Tools [Google Scholar]
- 13.Pinheiro M, Pinto C, Peixoto A et al. (2015) Target gene mutational pattern in Lynch syndrome colorectal carcinomas according to tumour location and germline mutation. Br J Cancer 113(4):686–692. doi: 10.1038/bjc.2015.281 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Young J, Simms LA, Biden KG et al. (2001) Features of colorectal cancers with high-level microsatellite instability occurring in familial and sporadic settings: parallel pathways of tumorigenesis. Am J Pathol 159(6):2107–2116. doi: 10.1016/S0002-9440(10)63062-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kariola R, Abdel-Rahman WM, Ollikainen M, Butzow R, Peltomaki P, Nystrom M (2005) APC and beta-catenin protein expression patterns in HNPCC-related endometrial and colorectal cancers. Fam Cancer 4(2):187–190. doi: 10.1007/s10689-004-6130-4 [DOI] [PubMed] [Google Scholar]
- 16.Ahadova A, von Knebel Doeberitz M, Blaker H, Kloor M (2016) CTNNB1-mutant colorectal carcinomas with immediate invasive growth: a model of interval cancers in Lynch syndrome. Fam Cancer 15(4):579–586. doi: 10.1007/s10689-016-9899-z [DOI] [PubMed] [Google Scholar]
- 17.Miyaki M, Iijima T, Kimura J et al. (1999) Frequent mutation of β-catenin and APC genes in primary colorectal tumors from patients with hereditary nonpolyposis colorectal cancer. Cancer Res 59(18):4506–4509 [PubMed] [Google Scholar]
- 18. Yang J, Zhang W, Evans PM, Chen X, He X, Liu C (2006) Adenomatous polyposis coli (APC) differentially regulates beta-catenin phosphorylation and ubiquitination in colon cancer cells. J Biol Chem 281(26):17751–17757. doi: 10.1074/jbc.M600831200 [DOI] [PubMed] [Google Scholar]
- 19.Jiang X, Hao HX, Growney JD et al. (2013) Inactivating mutations of RNF43 confer Wnt dependency in pancreatic ductal adenocarcinoma. Proc Natl Acad Sci USA 110(31):12649–12654. doi: 10.1073/pnas.1307218110 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Koo BK, van Es JH, van den Born M, Clevers H (2015) Porcupine inhibitor suppresses paracrine Wnt-driven growth of Rnf43;Znrf3-mutant neoplasia. Proc Natl Acad Sci USA 112(24):7548–7550. doi: 10.1073/pnas.1508113112 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Janku F, Connolly R, LoRusso P et al. (2016) Abstract C45: phase I study of WNT974, a first-in-class Porcupine inhibitor, in advanced solid tumors. Mol Cancer Ther 14(12 Supplement 2):C45 [Google Scholar]
- 22.Liu J, Pan S, Hsieh MH et al. (2013) Targeting Wnt-driven cancer through the inhibition of Porcupine by LGK974. Proc Natl Acad Sci USA 110(50):20224–20229. doi: 10.1073/pnas.1314239110 [DOI] [PMC free article] [PubMed] [Google Scholar]