Skip to main content
. 2018 Jul 25;7:e36392. doi: 10.7554/eLife.36392

Key resources table.

Reagent type (species)
or resource		 Designation Source or reference Identifiers Additional information
Cell line
(Homo sapiens)		 U2OS ATCC HTB-96
Transfected construct
(Homo sapiens)		 pBABE-puro
mTurquoise2-Nuf2		 this paper Nuf2 N-terminally labeled with
mTurquoise2; in retroviral vector
with puromycin selection marker
Transfected construct
(Homo sapiens)		 pBABE-hygro
mTurquoise2-Nuf2		 this paper Same as above, but with hygromycin
selection marker
Transfected construct
(Homo sapiens)		 pBABE-blast
mTurquoise2-Nuf2		 this paper Same as above, but with blasticidin
marker
Transfected construct
(Homo sapiens)		 pBABE-blast Aurora
B FRET sensor
(mTurquoise2/YPet)		 this paper modified from Addgene #45215;
Fuller et al. (2008)
Transfected construct
(Homo sapiens)		 Nuf2-targeted Aurora
B FRET sensor
(mTurquoise2/Ypet)		 this paper modified from Addgene #45215;
Fuller et al. (2008)
Transfected construct
(Homo sapiens)		 mTurquoise2-TC this paper mTurquoise2 with tetracysteine
motif at the C-terminus
Transfected construct
(Homo sapiens)		 WT-Hec1-LSSmOrange this paper modified from WT-Hec1-GFP
from Jennifer DeLuca
Transfected construct
(Homo sapiens)		 9A-Hec1-LSSmOrange this paper modified from 9A-Hec1-GFP
from Jennifer DeLuca
Transfected construct
(Homo sapiens)		 2D(S44,55D)-Hec1
-LSSmOrange		 this paper modified from 2D-Hec1-GFP
from Jennifer DeLuca
Transfected construct
(Homo sapiens)		 9D-Hec1-LSSmOrange this paper modified from 9D-Hec1-GFP
from Jennifer DeLuca
Transfected construct
(Homo sapiens)		 INCENP-mCherry other Gift from Michael Lampson
Recombinant DNA
reagent		 pSpCas9(BB)−2A-GFP
(pX458)		 Ran et al. (2013) Addgene: #48138
Sequence-based
reagent		 Donor single-stranded DNA
for TC tag insertion at the
C-terminus of TUBB		 IDT ssDNA: cgtctctgagtatcagcagtacca
ggatgccaccgcagaagaggaggaggattt
cggtgaggaggccgaagaggaggcctGCT
GTCCCGGCTGTTGctaaggcagagcccc
catcacctcaggcttctcagttcccttagccgtc
ttactcaactgcccctttcctctccctcaga;
sgRNA target sequence: GAGGCCGAA
GAGGAGGCCTA
Sequence-based
reagent		 Hec1 siRNA Qiagen Cat#: SI02653567
Peptide, recombinant
protein		 TC-peptide Genscript Custom designed Synthesized, Ac-AEEEACCPGCC-NH2
Commercial assay
or kit		 Amaxa Cell Line
Nucleofector Kit V		 Lonza Cat#:VCA-1003
Commercial assay
or kit		 Ingenio Electroporation
Kit		 Mirus Cat#: MIR 50118
Commercial assay
or kit		 Lipofectamine RNAiMax Thermo Fisher Cat#:13778075
Chemical compound,
drug		 FlAsH-EDT2 Thermo Fisher Cat#:T34561
Chemical compound,
drug		 1,2-Ethanedithiol (EDT) Alfa Aesar Cat#:540-63-6
Chemical compound,
drug		 ZM447439 Enzo Life Sciences Cat#:BML-EI373
Chemical compound,
drug		 Paclitaxel (Taxol) Enzo Life Sciences Cat#:BML-T104
Chemical compound,
drug		 5-iodotubercidin (5-ITu) Enzo Life Sciences Cat#:BML-EI29
Chemical compound,
drug		 S-Trityl-L-cysteine Sigma Aldrich Cat#:164739–5G
Chemical compound,
drug		 Alexa Fluor 488 Thermo Fisher Cat#:A20000
Chemical compound,
drug		 Sodium 2-
mercaptoethanesulfonate		 Sigma Aldrich Cat#:M1511
Software, algorithm Interactive kinetochore
FLIM-FRET analysis
GUI (MATLAB 2016)		 This paper http://doi.org/10.5281/zenodo.1198705;
copy archived at https://github.com/elifesciences-publications/FLIM-Interactive-Data-Analysis
Software, algorithm Aurora B concentration at
NDC80 analysis (Python 3)		 This paper http://doi.org/10.5281/zenodo.1198702;copy archived at https://github.com/elifesciences-publications/AuroraConcentrationAnalysis
Software, algorithm CAMPARI (v2) Pappu Lab http://campari.sourceforge.net/V2/index.html
Software, algorithm Rosetta 3.8 RosettaCommons RRID:SCR_015701
Other 25 mm #1.5 poly-D-lysine
coated round coverglass		 neuVitro Cat#:GG-25–1.5-pdl
Other FluoroBrite DMEM Thermo Fisher Cat#:A1896701
Other Microtubule structure Zhang et al. (2015) PDB 3JAS
Other Human NDC80 bonsai
decorated tubulin dimer		 Alushin et al. (2010) PDB 3IZ0
Other mTurquoise structure Stetten et al.
(unpublished)		 PDB 4B5Y