Table 3.
Sequences, annealing temperatures, amplicon length, and efficiency of primers used for real-time PCR quantification of gene expression
Item | Forward primer (5ʹ to 3ʹ) | Reverse primer (5ʹ to 3ʹ) | T m,1 °C | Amplicon length | Efficiency |
---|---|---|---|---|---|
Small intestine genes | |||||
Copper transport protein -1 | CCATGATGATGCCTATGACCTT | ATAGAACATGGCTAGTAAAAACACC | 60.5 | 131 | 1.12 |
Glucan-like peptide-1 | TACTTCTGGCTGCTGGTGGAG | ACCCCAGCCTATGCTCAGGTA | 62.4 | 104 | 1.11 |
Intestinal fatty acid binding protein | CCTCGCAGACGGAACTGAAC | GTCTGGACCATTTCATCCCCG | 64.5 | 135 | 1.03 |
Normalizing gene | |||||
Ribosomal protein L4 | AGGAGGCTGTTCTGCTTCTG | TCCAGGGATGTTTCTGAAGG | 60.5 | 184 | 1.06 |
1 T m = melting temperature.