Antibodies |
Rabbit polyclonal anti-SH3GL3 |
Abcam |
Cat#: ab184008 |
Mouse monoclonal anti-SH3GL3 |
Santa Cruz Biotech |
Cat#: SC-376592 |
Rabbit polyclonal anti-TIAM1 |
Santa Cruz Biotech |
Cat#: SC-872 |
Mouse monoclonal anti-TIAM1 |
Santa Cruz Biotech |
Cat#: SC-393315 |
Mouse monoclonal anti-Rac1 |
Cytoskeleton Inc. |
Cat#: ARC03 |
Mouse monoclonal anti-FLAG |
Sigma |
Cat#: F-3165 |
Rabbit polyclonal anti-His6 tag |
Abcam |
Cat#: ab9108 |
Rabbit Polyclonal anti-Ki-67 |
Abcam |
Cat#: ab16667 |
Mouse monoclonal anti-TROMA-1 |
DSHB |
Cat#: TROMA-1 |
Rabbit polyclonal anti-dsRed |
Takara |
Cat#: 632496 |
Mouse monoclonal anti-TIAM1 |
FHCRC Shared Resource |
4E7b |
Bacterial and Virus Strains |
BL21 (DE3) Escherichia Coli |
Thermo Fisher Scientific |
Cat#: C601003 |
Mach1 T1 Escherichia Coli |
Thermo Fisher Scientific |
Cat#: C8681201 |
Biological Samples |
|
|
Chemicals, Peptides, and Recombinant Proteins |
Dako serum free block |
Agilent |
Cat#: X090930-2 |
Acti-Stain 488 Phalloidin |
Cytoskeleton Inc |
Cat#: PHDG1-A |
DAPI |
Sigma |
Cat#: D9542 |
Malachite Green Oxalate Salt |
Sigma |
Cat#: M6880 |
Prolong Diamond antifade reagent |
Molecular Probes |
Cat#: P36965
|
Live Imaging Solution |
Thermo Fisher Scientific |
Cat#: A14291DJ |
0.25% Trypsin EDTA |
Thermo Fisher Scientific |
Cat#: 25200-056 |
Opti-MEM Media |
Thermo Fisher Scientific |
Cat#: 31985062 |
Leibovitz's L-15 Medium |
Thermo Fisher Scientific |
Cat#:11415064 |
Collagen Type 1 |
Thermo Fisher Scientific |
Cat#: A1048301 |
Matrigel |
Corning |
Cat#: 354234 |
Fetal Bovine Serum |
Omega Scientific |
FB-01 |
1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE) |
NOF America |
Cat#: ME-6060 |
1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) |
NOF America |
Cat#: MC-6081 |
1,2-dioleoyl-sn-glycero-3-phospho-l-serine (DOPS) |
NOF America |
Cat#: MS-8181LS |
1,2-dioleoyl-sn-glycero-3-phospho-(1'-myo-inositol-4',5'-bisphosphate) (PIP2) |
Avanti Polar Lipids |
Cat#:850155 |
Recombinant EndoA1 BAR domain |
Laboratory of Jihong Bai |
BJP-B01 |
Recombinant EndoA2 BAR domain |
Laboratory of Jihong Bai |
BJP-B595 |
Recombinant EndoA3 BAR domain |
Laboratory of Jihong Bai |
BJP-B596 |
Recombinant Full Length EndoA1 |
Laboratory of Jihong Bai |
BJP-B237 |
Recombinant Full Length EndoA2 |
Laboratory of Jihong Bai |
BJP-R41 |
Recombinant Full Length EndoA3 |
Laboratory of Jihong Bai |
BJP-R42 |
Recombinant TIAM1 (His6-PDZ-DH) domain |
This paper |
BJP-674 |
Recombinant PAK-PBD |
This paper |
BJP-A144 |
Recombinant RAC G15A |
This paper |
BJP-R85 |
DMEM |
Thermo Fisher Scientific |
Cat#: 11965092 |
Critical Commercial Assays |
Incucyte zoom system |
Essen Bioscience |
Cat#: 4647 |
FM 1–43 Dye (N-(3-Triethylammoniumpropyl)-4-(4-(Dibutylamino) Styryl) Pyridinium Dibromide) |
Thermo Fisher Scientific |
Cat#: T3163 |
FM 4–64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) |
Thermo Fisher Scientific |
Cat#: T13320
|
Lipofectamine RNAiMAX |
Thermo Fisher Scientific |
Cat#: 13778030 |
Lipofectamine 2000 |
Thermo Fisher Scientific |
Cat#: 11668027 |
RAC/CDC 42 Inhibitor ML141 Inhibitor |
Millipore Sigma |
Cat#: 217708 |
PTEN Inhibitor VO-OHpic |
Sigma |
Cat#: V8639 |
PTEN Inhibitor bPV(HOpic) |
Sigma |
Cat#: SML0884 |
Dynamin Inhibitors Toolbox |
Abcam |
Cat#: ab120468 |
Deposited Data |
Experimental Models: Cell Lines |
Human colon adenocarcinoma cells: DLD1 |
ATCC |
Cat#: CCL-221 |
Human colon adenocarcinoma cells: HCT116 |
ATCC |
Cat#: CCL-247 |
Human colon adenocarcinoma cells: SW480 |
ATCC |
Cat#: CCL-228 |
MLV-based retroviral packaging cell line: PT67 |
ATCC |
Cat#: CRL-12284 |
Human Embryonic Kidney Cells |
Sigma |
Cat#: 85120602 |
Experimental Models: Organisms/Strains |
D. rerio: WT AB |
Laboratory of Cecilia Moens |
ZFIN: ZDB-GENO-960809-7 |
M. musculus: NU/NU |
Charles River |
Crl:NU-Foxn1nu
|
Oligonucleotides |
3' for EndoA2 BAR in A2 BAR-A3SH3 chimera |
ATGTTCACAGGCTTTGGCATGAACTCCCGCTTGGG |
5' for EndoA2 BAR in A2 BAR-A3SH3 chimera |
ATGCCAAAGCCTGTGAACA |
3' for EndoA3 BAR in A3 BAR-A2 SH3 chimera |
GGCTCCCGGGGCCGGGGCTTGAAcTCTCGCTTGGGG |
5' for EndoA3 BAR in A3 BAR-A2 SH3 chimera |
AAGCCCCGGCCCCGG |
5' for Lifeact EGFP in pBABE Hygro |
CTCCTTCTCTAGGCGCCGGCCGGTACCATGGGCGTGGCCGACCTGATCAAGAAGTTC |
3' for Lifeact EGFP in pBABE Hygro |
GGGTCGACCACTGTGCTGGCGAATTCTTACTTGTACAGCTCGTCCATGCCG |
5' for EndoA3ΔN truncation |
CTCTAGGCGCCGGCCGGATCCATGATAAGTGGTGCCGAAGGAACG |
5' for K171N mutant of EndoA3 |
CGCCTGGATTATGATTATAACAAGCGGCGGGTAGGTAAG |
3' for K171N mutant of EndoA3 |
CTTACCTACCCGCCGCTTGTTATAATCATAATCCAGGCG |
5' for R174L of EndoA3 |
TATGATTATAAAAAGCGGCTGGTAGGTAAGATCCCCGAG |
3' for R174L of EndoA3 |
CTCGGGGATCTTACCTACCAGCCGCTTTTTATAATCATA |
Recombinant DNA |
Plasmid: mEndoA3-mCherry in pBABE Puro |
Laboratory of Jihong Bai |
BJP-R82.8 |
Plasmid: mEndoA3ΔN-mCherry in pBABE Puro |
Laboratory of Jihong Bai |
BJP-R81.1 |
Plasmid: Chimera mEndoA3 N-BAR::mEndoA2 SH3::3xFlag in pBABE PURO |
Laboratory of Jihong Bai |
BJP-R73 |
Plasmid: Chimera mEndoA2 N-BAR::mEndoA3 SH3::3xFlag in pBABE PURO |
Laboratory of Jihong Bai |
BJP-R72 |
Plasmid: mEndoA1::3xFlag in pBABE Puro |
Laboratory of Jihong Bai |
BJP-R55 |
Plasmid: mEndoA2::3xFlag in pBABE Puro |
Laboratory of Jihong Bai |
BJP-R56 |
Software and Algorithms |
FIJI |
NIH |
https://fiji.sc |
FlowJo |
Tree Star |
www.flowjo.com |
Tissue Fax |
Tissuegnostics |
www.tissuegnostics.com/ |
Zen |
Zeiss |
www.zeiss.com |
Fluoview (FV10-ASW) |
Olympus Corporation |
http://www.olympusamerica.com/ |
Metamorph Microscopy and Image Analysis Software |
Molecular Devices |
www.moleculardevices.com |
Other |
Human Tissue Microarray |
US Biomax |
Cat#: BC05118C |