Table 1.
Common bean TCP transcripts with miR319 binding sites.
Gene name | Alignment (penalty score) | Expression (FPKM) |
|
---|---|---|---|
Roots | Nodules | ||
pvu-miR319d | 22 CUUCCUCGAGGGGAAGUCAGGU 1 | ||
: . : . : : : : : : : : : : : : : : | |||
Phvul.005G067950 | 1362 CAGAGGGGACCCCUUCAGUCCA 1383 (3.5) | 16 | 8 |
pvu-miR319d | 22 CUUCCUCGAGGGGAAGUCAGGU 1 | ||
: . : . : : : : : : : : : : : : : : | |||
Phvul.0llGl56900 | 1974 CAGAGGGGACCCCUUCAGUCCA 1995 (3.5) | 2 | 3 |
pvu-miR319d | 22 CUUCCUCGAGGGGAAGUCAGGU 1 | ||
: : . : . : . : : : : : : : : | |||
Phvul.005G097200 | 1317 CUUGGCCUUUCUCUUCACUCCU 1338 (6.0) | 11 | 11 |
pvu-miR319d | 22 CUUCCUCGAGGGGAAGUCAGGU 1 | ||
: : : : : : : : : : : : : : : : | |||
Phvul.011G136115 | 1533 CAAAGUGAGACCCUUCAGUCCA 1554 (7.5) | 0 | 0 |
Pairing of four TCP putative target genes identified with a miR319 binding site (Formey et al., 2015). Watson-Crick base pairing is indicated by two dots, G-U base pairing by one dot and mismatches are empty. Penalty scores shown in parenthesis were calculated as described by Jones-Rhoades and Bartel (2004). Expression values (FPKM, Fragments Per Kilo Million) from Phaseolus vulgaris release v2.1 from Phytozome 12 database, are shown.