Table 1.
Primers and restriction enzymes used for genotyping the HSP70 (1053G>A) gene polymorphism
| Polymorphism | Primer (5ˊ-3ˊ) | Size | Enzyme |
|---|---|---|---|
| 1053 G>A | F: CATCGACTTCTACACGTCCA | 1117 bp | PstI |
| R: ATACTAGGAAATGCAAAGTCT | |||
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.