| Sequencing primer | sequence |
| Cassette 1 reverse primer (CBirA* fusion) | TATACTTTCTAGAGAATAGGAAC |
| Cassette 2 reverse primer (NBirA* fusion) | GTGGTTTGTCCAAACTCATC |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.