| Change | To | Example case of rpt4+ |
| Template vector | pFA6a-3HA-KANMX6 | |
| Vector-binding sequence of p7 | ATTACGCTGCTCAGTGCTGA | ttgctgacctgaagaaacttgaaggtacaattgattaccaaaagctttag ATTACGCTGCTCAGTGCTGA |
| Hanging sequence of p7 | The last 50bp sequence including the stop codon | |
| Hanging sequence of p8 | The first 50bp sequence right after the stop codon (complementary sequence) | AATCTTCATCGGTAAACTTATCATTTCATGGCTTTTTGGATATATGTGCA GAATTCGAGCTCGTTTAAAC |
| Sequence of p9 | Start right after the stop codon | tgcacatatatccaaaaagccatgaa |
| Sequence of p10 | Produce ~500bp fragment with p9 (complementary seqeucne) | TAGACGTTTTTCCTCGTTTCTTTGTC |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.