| Plasmids | Relevant characteristics | Reference |
| pAH7 | Pnat parB-yfp;Mx8 attP; TetR | 19 |
| pAH53 | PpomZ mCherry-pomX; Mx8 attP ; KmR | 16 |
| pDS150 1 | Pnat ftsZ-gfp ; mxan18-19 ; TetR | This study |
| pMR3691 | Plasmid for vanillate inducible gene expression | 18 |
| pKA51 | Pnat ftsZ-gfp ; Mx8 attP; TetR | 17 |
| 1 pDS150: pDS150 is a derivative of pKA51 in which the Mx8 attP site was replaced with the mxan18-19 intergenic region. For this the mxan18-19 intergenic region was amplified from pMR3691 with primers Mxan18-19 fwd BsdRI (GCGATCATTGCGCGCCAGACGATAACAGGC) and Mxan18-19 rev BlpI (GCGGCTGAGCCCGCGCCGACAACCGCAACC) and cloned into pKA51. |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.