Optimization of the first small-molecule relaxin/insulin-like family peptide receptor (RXFP1) agonists: Activation results in an antifibrotic gene expression profile

Abstract

A dose responsive quantitative high throughput screen (qHTS) of >350,000 compounds against a human relaxin/insulin-like family peptide receptor (RXFP1) transfected HEK293 cell line identified 2-acetamido-N-phenylbenzamides 1 and 3 with modest agonist activity. An extensive structure-activity study has been undertaken to optimize the potency, efficacy, and physical properties of the series, resulting in the identification of compound 65 (ML-290), which has excellent in vivo PK properties with high levels of systemic exposure. This series, exemplified by 65, has produced first-in-class small-molecule agonists of RXFP1 and is a potent activator of antifibrotic genes.

Graphical Abstract

INTRODUCTION

The small-peptide hormone relaxin was discovered in 1926 and is primarily associated with pregnancy, due to its effects to relax pubic ligaments and soften the cervix to facilitate parturition.^1,2 Since then it has been shown that blood concentrations of relaxin rise during the first trimester of pregnancy, stimulating cardiovascular and renal adjustments to accommodate the increased nutritional demands of the growing fetus and the elevated requirements for renal clearance of metabolic waste.³ Relaxin production increases cardiac output, arterial compliance, renal blood flow and a decrease in systemic vascular resistance during pregnancy.^4–6 Both clinical and non-clinical studies using this hormone reinforce these cardiovascular effects in both males and females, which suggest the pharmacological utility of relaxin as a modulator of cardiovascular and renal functions in humans.^7,8

The target of relaxin is a group of G-protein coupled receptors, relaxin/insulin-like family peptide receptor (RXFP).^9,10 Some of the physiological effects of relaxin are mediated by its interaction with RXFP1, which modulates several signal transduction pathways.^11,12 Relaxin activation of RXFP1 up-regulates the endothelin system which leads to vasodilation. Activation also promotes extracellular matrix remodeling through regulation of collagen deposition, proliferation, cell invasiveness, and perhaps most importantly, overall tissue homeostasis. It also moderates inflammation by reducing levels of inflammatory cytokines such as TNF-α and TGF-β, as well as the induction of angiogenesis via the activation of transcription of vascular endothelial growth factor (VEGF).¹³

Understanding the biological effects of RXFP1 activation by relaxin has led to the evaluation of relaxin as a pharmacologic agent for the treatment of patients with acute heart failure (AHF), preeclampsia, and hypertensive disease.^6,14 A recent phase 3 clinical trial utilizing recombinant human relaxin-2 (serelaxin) met its primary endpoint of improving dysponea through the fifth day in patients admitted for acute heart failure.^15,16 We have previously reported the identification and evaluation of a series of small-molecule human relaxin agonists.^17,18 Optimized compounds from this series are potent and highly selective activators of RXFP1 with similar efficacy to the natural hormone in functional assays.^19,20 Using quantitative high-throughput screening, over 350,000 compounds from our Molecular Libraries Small Molecule Repository (MLSMR) were screened in an effort to identify small-molecule agonists of RXFP1.²¹ This small molecule library was created by the NIH to combine chemical resources from both academic and private institutions to increase chemical space diversity of compounds for a large variety of screening campaigns. In this disclosure we present the syntheses, SAR studies, and compound optimization which led to the identification of preclinical candidate 65.

RESULTS AND DISCUSSION

The ability of these compounds to increase cyclic adenosine monophosphate (cAMP) levels in a human RXFP1 transfected HEK293 cell line was measured, and two compounds (1 and 3), both having a unifying molecular motif of 2-acetamido-N-phenylbenzamide were discovered (Figure 1).¹⁷

Figure 1.

Initial RXFP1 hits from the Molecular Probe Center Network Library.

The activity is reported through two parameters: EC₅₀ (concentration necessary to reach 50% of maximum cAMP signal) and maximum response (efficacy indicated as the maximum observed increase in cAMP response), which were used to perform SAR analysis. Efficacies were normalized to forskolin, which had an EC₅₀ of 47 nM and a defined maximum response of 100%.²²

Initial measurements of aqueous kinetic solubility of 1 and 3 (1.6 μg/mL, 3.7 μM and 0.9 μg/mL, 2.2 μM respectively) show poor solubility for these compounds. However, in assessing the stability of compounds 1 and 3 in mouse liver microsomes, compound 3 demonstrated very good stability after 60 minutes (70% parent remaining) versus 1 (2% parent remaining), so these data and the inherent problems associated with furans in mammalian metabolism led us to focus on the optimization of the cyclohexyl series based on compound 3.²³ The general synthetic scheme to these is represented in Scheme 1.

Scheme 1.

Synthesis of the Western Cyclohexyl and Optimized Analogues

Reagents and Conditions: For 3–22, 62–67: (a) acid chloride, DCM, TEA, 0 °C to RT, 1–3 h; (b) substituted aniline or benzylamine, 2M AlMe₃ in toluene, 100 °C, 16 h; (c) For 17: 16, DCM, MCPBA, RT, 12h; (d) For 18: 13, phenylboronic acid, Pd(PPh₃)₄, 2M Na₂CO₃, DMF, microwave irrad., 100 °C, 1 h; For 19: 13, 2-(trifluoromethylphenyl)boronic acid, Pd(PPh₃)₄, 2M Na₂CO₃, DMF, microwave irrad., 100 °C, 1 h; For 20: 13, 3-(trifluoromethylphenyl)boronic acid, Pd(PPh₃)₄, 2M Na₂CO₃, DMF, μW., 100 °C, 1 h;

The first series of compounds 3–22 (Table 1) were prepared in a straightforward manner from 2 (see Experimental Standard Procedures), with the first amide formation performed by reaction with cyclohexylcarbonyl chloride followed by subsequent AlMe₃ mediated second amide formation with the appropriate aniline or amine. This direct amidation using an aniline and an ester proved to be robust and broad in scope. Compounds 18–20 were prepared from bromo-compound 13 using standard Suzuki conditions.

Table 1.

SAR of the Cyclohexyl-2-Acetamido-N-Phenylbenzamide Series

Cmpd	R	EC50(μM)a	Max. Responseb
3	3-trifluoromethylphenyl	1.88	92%
4	4-trifluoromethylphenyl	94.0	46%
5	phenyl	94.0	57%
6	2-methylphenyl	inactive	N/A
7	3-methylphenyl	37.4	65%
8	4-methyphenyl	187	32%
9	3-tert-butlyphenyl	2.65	70%
10	3-nitrophenyl	5.93	93%
11	3-fluorophenyl	13.3	81%
12	3-chlorophenyl	3.34	89%
13	3-bromophenyl	2.65	91%
14	3-methoxyphenyl	37.4	74%
15	3-thiomethylphenyl	5.29	84%
16	3-trifluoromethythiophenyl	1.88	90%
17	3-trifluoromethylsulfonylphenyl	1.06	87%
18	3-biphenyl	inactive	N/A
19		2.65	74%
20		inactive	N/A
21		inactive	N/A
22		9.40	45%

^aThe EC₅₀ is expressed in micromolar and is the concentration necessary to reach 50% of maximum cAMP signal.

^bThe maximum response is the efficacy indicated as the maximum observed increase in cAMP response.

Table 1 discloses the initial results of our SAR studies. It is clear upon viewing the data that the 3-position of the pendant R-phenyl group provides the best agonism activity. Most of the compounds have single digit micromolar acivity, except for 7 (37.4 μM), 18 and 20 (both inactive). Interestingly, the 3-trifluoromethylbiphenyl derivative 19 is active (EC₅₀ = 2.65 mM), leading us to believe that the trifluoromethyl moiety in this part of the molecule could be important by promoting the activation of RXFP1. This is further supported by compounds 16 and 17, the latter trifluoromethylsulfonyl compound being the most potent in this set, having an EC₅₀ of 1.06 μM with an 87% of maximal activity. It is also worth noting that tert-butyl compound 9 maintains activity, and that less polar substituents may be preferred over more polar ones such as the 3-methoxy derivative 14.

The unsubstituted phenyl compound 5 is minimally active as is 4-trifluoromethylsulfonyl phenyl compound 4. The inactivity of compound 6 might indicate that substituents at the ortho position impair agonism. Thus, either no substitution or 2- and 4-phenyl substitutions are deleterious to RXFP1 activation, with the 3-substituted phenyl compounds generally being more active. Drawing parallels to compounds 1 and 3, we combined the cyclohexyl and furanyl chemotypes, exemplified by compound 22, which retained some activity but did not encourage further investigation.

We then explored the replacement of the cyclohexyl group with various saturated alkyl rings, alkyl groups and differentially substituted aryl rings, while holding the 3-trifluoromethylphenyl eastern hemisphere region of the molecule constant (Scheme 2). Readily available BOC-protected anthranilic acid 23 was coupled to 3-trifluoromethylaniline and deprotected to afford 24a (which is also commercially available), and then converted to the amides 25–44 by reacting with the appropriate acid chloride, or coupled with the apprpriate carboxylic acid in the case of the cycloalkyl isosteres 27–30 (Table 2). The ethers 43–44 required an additional synthetic step using CuI catalyzed coupling of either 2-methoxyethan-1-ol or dimethylaminoethan-1-ol with iodo-compound 24b. It is evident from the data in Table 2 that the ring size of R is important. The cycloalkyl analogues 28–30 maintain good potency while the smaller cyclopropyl adduct 27 experiences a significant (> 4-fold) reduction in activity from the parent compound 3.

Scheme 2.

Synthesis of 3-Trifluoromethyl Analogues 25–44

Reagents and Conditions: (a) 3-trifluoromethylaniline, DCM, DMAP, EDC, 24 h; (b) TFA, DCM, 0 °C; (c) For 24b: 2-iodobenzoyl chloride, DCM, TEA, 0 °C, 1 h; (d) For 25–26, 31–42: aryl acid chloride, DCM, TEA, RT, 2 h; For 27–30: cycloalkyl carboxylic acid, DMF, EDC, DMAP, 12 h; (e) For 43: 24b, 2-methoxyethan-1-ol, Cs₂CO₃, CuI, 1,10-phenanthroline, toluene, sealed tube, 110 °C, 24 h; For 44: 24b, 2-dimethylaminoethan-1-ol, Cs₂CO₃, CuI, 1,10-phenanthroline, toluene, sealed tube, 110 °C, 24 h;

Table 2.

SAR of the Western Hemisphere N-3-Trifluorophenylbenzamide Series

Cmpd	R	EC50 (μM)a	Max. Responseb
25	3-pentyl	5.29	59%
26	1-butyl	5.29	94%
27	cyclopropyl	8.38	79%
28	cyclobutyl	2.97	75%
29	cyclopentyl	2.36	88%
30	cycloheptyl	2.11	75%
31	benzyl	8.38	86%
32	3-pyridyl	5.93	95%
33	4-methoxyphenyl	9.40	71%
34	phenyl	1.32	64%
35	3-methoxyphenyl	1.88	94%
36	2-methoxyphenyl	0.334	99%
37	2-methylphenyl	4.20	90%
38	2-chlorophenyl	3.74	92%
39	2-trifluoromethoxyphenyl	1.18	96%
40	2-ethoxyphenyl	0.265	94%
41	2-isopropoxyphenyl	0.471	99%
42	2,6-dimethoxyphenyl	7.47	42%
43		0.747	98%
44		3.74	92%

^aThe EC₅₀ is expressed in micromolar and is the concentration necessary to reach 50% of maximum cAMP signal.

^bThe maximum response is the efficacy indicated as the maximum observed increase in cAMP response.

Compounds 27–30 clearly demonstrated a correlation between activity and ring size (3 < 4 < 5 < 6 > 7, EC₅₀ = 8.38, 2.97, 2.36, 1.88, and 2.11 μM, respectively), with the 6-membered ring being the optimal size for activity. The branched and linear alkanes 25 and 26 are tolerated but not ideal for agonism activity. Again, as in compound 8, substitution at the 4-position substantially reduces the activity of compound 33 relative to 2-substitution (compound 36). The phenyl example 34 retains good activity while the 3-pyridyl 32 is an unfavorable substitution. A clear SAR profile begins to manifest as seen in the activity of micromolar to submicromolar 2-alkyl ethers 36, 39–41 and 43, with the 2-ethoxy compound 43 having the best activity at EC₅₀ = 265 nM. These data were very encouraging as we demonstrated the additive effects of the 3-trifluorophenyl eastern hemisphere and the 2-alkoxyphenyl western hemisphere.

Imparting more solubility to this series of compounds would be desirable. Our next objective was to assess whether the central phenyl ring could tolerate derivatization in the form of pyridine analogues and retain, if not improve, potency and especially the solubility.

The four possible central core pyridine isomers were synthesized using readily available and inexpensive aminopyridines 45–48 (Scheme 3). From our SAR data the 3-sulfonylphenyl was chosen as a constant for the eastern region and 2-ethoxyphenyl was chosen for the western hemisphere. The resultant aminopyridines 49–52 were then assayed and the results are shown in Table 3. There is a substantial loss in activity of all but 3-pyridyl compound 51, which exhibits approximately a 3-fold reduction in activity from compound 40.

Scheme 3.

Synthesis of Pyridine Core Derivatives

Reagents and Conditions: (a) 2-ethoxybenzoylchloride, DCM, TEA, 0 °C-RT, 2 h, 11–94%; (b) 3-trifluoromethylsulfonylaniline, 2M Al-Me₃ in toluene, 100 °C, 12 h, 56–75%;

Table 3.

SAR of Pyridine Central Core Derivatives

Cmpd	AC50	Max. Response	PBS Solubilitya	RLM Stability (t1/2 min)
49 (N1)	1.67	98%	<1 mM	19.85
50 (N2)	2.97	99%	<1 mM	ND
51 (N3)	0.747	97%	ND	>30
52 (N4)	4.71	73%	<1 mM	>30

^aPion’s μSOL assay for kinetic solubility determination was used. Saturation shake-flask solubility method was adapted to a 96-well microtiter plate format and a co-solvent method with n-propanol as the reference compound was utilized.

The modification of the central benzamide linker was evaluated next, where the western region sulfonamide 53, N-methylated amides 54 and 55, amine 57, thiophene surragate 59, and 1,3-benzamide 61 were prepared using the standard chemistry detailed in this manuscript (Scheme 4), and then evaluated in the cAMP assay (Table 4). As our binding model predicts (vide infra), the 1,3 benzamide linked compound 61 was inactive, as were the N-methylated version 54 and sulfonamide 53. Methylated amide 55 retained weak activity, and surprisingly, so did the ethylmethoxyaniline 57. The thiophene isostere 59 had the best activity (EC₅₀ = 2.35 μM).

Scheme 4.

Benzamide Linker Modifications: Sulfonamide, Amine, N-Methyl and 3-Acetamido-N-Phenylbenzamide Compounds

Reagents and Conditions:: (a) 2-ethoxyphenylsulfonylchloride, DCM, TEA, 0 °C-RT, 2 h; (b) 3-trifluoromethylsulfonylaniline, 2 M AlMe₃ in toluene, 100 °C, 1–16 h, 10–82%; (c) 2-methoxybenzoylchloride, DCM, TEA, RT; For 54: (d) NaH, DMF, CH₃I, 0 °C, 1.5 h, then (b); For 55: (b), then (d); (e) 3-trifluoromethylsulfonylaniline, DCM, TEA, 0 °C-RT; (f) 2-dimethylaminoethan-1-ol, Cs₂CO₃, CuI, 1,10-phenanthroline, toluene, sealed tube, 110 °C, 24 h;

Table 4.

SAR of Benzamide Linker Modifications

Cmpd	R1	R2	R3	R4	Linker	EC50(μM)a	Max.b Response
53		H	H	SO2CF3		inactive	N/A
54		CH3	H	CF3		inactive	N/A
55		H	CH3	CF3		29.7	77%
57		H	H	CF3		59.3	63%
59		H	H	SO2CF3		2.36	95%
61		H	H	CF3		inactive	N/A

^aThe EC₅₀ is expressed in micromolar and is the concentration necessary to reach 50% of maximum cAMP signal.

^bThe maximum response is the efficacy indicated as the maximum observed increase in cAMP response.

A clear picture had emerged of the optimal SAR requirements for the 2-acetamido-N-phenylbenzamide series to effect RXFP1 activation. From the SAR data we determined that the 2-alkoxyphenyl western hemisphere and 3-trifluoromethylsulfonyl eastern hemisphere groups offered the best opportunity for discovering the most potent compounds, and gratifyingly, they did. Compounds 62–67 were synthesized according to the procedure in Scheme 1. The assay results of these compounds are shown in Table 5. The larger (65–67) or more hydrophobic alkyl groups (such as 64) confer the best activity, e.g., 62 or 63 (EC₅₀ = 0.188 μM) as compared to compound 67 (EC₅₀ = 0.047 μM). That the 3-trifluoromethylsulfonyl is a superior pharmacophore for activity to 3-trifluoromethyl on the eastern region phenyl is confirmed comparing 36 to 62 (EC₅₀ = 0.334 μM versus EC₅₀ = 0.188 μM), 40 to 63 (EC₅₀ = 0.265 μM versus EC₅₀ = 0.188 μM), and especially the obvious contrast between 41 and 65 (EC₅₀ = 0.471 μM versus EC₅₀ = 0.094 μM).

Table 5.

SAR of Optimized 2-Acetamido-N-Phenylbenzamide Compounds Including ML-290

Cmpd	R	EC50 (μM)a	Max. Responseb	ATP toxicity EC50 (μM)c	PBS Solubility (μM)d	Stability (t1/2 min)
						RLM	MLMe
62	OMe	0.188	99%	29.7	6.3	>30	ND
63	OEt	0.188	99%	18.8	<1.1	>30	1732
64	OCH2CF3	0.067	97%	29.7	3.3	>30	100
65	OCH(CH3)2	0.094	98%	18.8	7.0	28.2	122
66	OCH2CH2CH3	0.052	98%	9.4	17.0	26.8	133
67	OBu	0.047	98%	59.3	5.3	19.5	178

^aThe EC₅₀ is expressed in micromolar and is the concentration necessary to reach 50% of maximum cAMP signal.

^bThe maximum response is the efficacy indicated as the maximum observed increase in cAMP response.

^cCytotoxicity assay to measure the effect of compounds on cell viability by measuring ATP levels (ATPLite; Promega, Madison, WI).

^dKinetic solubility analysis in PBS solution performed by Analiza (www.analiza.com).

^eRodent microsomal stability analysis performed by Pharmaron (www.pharmaron.com).

We have previously reported the structural elucidation and insight into the activation of the activation of human relaxin family peptide receptor by 65.¹⁸ Exhaustive site-directed mutagenesis in conjunction with computational modeling analysis allowed us to develop a predictive model of our small molecule agonists’ mode of binding. (Figure 2). Figure 2 shows the binding model of compound 65 (ML-290) to the RXFP1 receptor. The intramolecular hydrogen bonding interaction of the amide carbonyl to the threonine 660 is essential for favorable conformational bias within the active site. The inactivity of compound 54 and to a lesser extent the reduced activity of 55 (vide supra) clearly demonstrate that the replacement of the N-amido hydrogen with a methyl group results in the disruption of the required active site conformation for binding to RXFP1, as well as altering the critical T660 H-bonding interaction to one of the sulfonyl oxygens.

Figure 2.

Predicted model of ML290 bound in the TM binding site of hRXFP1. The receptor hRXFP1 is shown in ribbon (white) and key residues are shown in sticks (brown). In addition to an intramolecular H-bond, ML290 (sticks in cyan) forms a hydrogen-bond with the backbone N atom of residue T660 in ECL3 (magenta).¹⁸

The microsome stability, PBS solubility, and toxicity in both rat and mice were investigated for compounds 62–67. Rat and mouse microsome stability are excellent for these compounds (Table 5). An improvement in PBS solubility was also observed for compounds 62 and 64–67. It can be argued that the sulonyl group imparts greater solubility to these compounds as compared to the more lipophilic thrifluoromethyl moiety.

As we previously reported, 65 was chosen as our lead compound for further PK analysis because of favorable profiles which included: (1) selectivity against HEK293 cells transfected with the RXFP2 receptor (2) decreased adenosine triphosphate (ATP) cytotoxicity, and (3) especially its ability to activate the transcription of the known relaxin target gene VEGF in human monocyte leukemia cells (THP1). ^{9, 17}

The pharmacokinetics of IV and PO delivery of 65 in mice was analyzed (Table 6). Compound 65 has an excellent half-life in plasma by both routes of administration and in heart by IV dosing, with the exposure in heart being about six times greater than plasma by IV administration. This is important as organ fibrosis (heart, liver, lung, etc) is an important indication of therapeutic intervention. While the plasma clearance is high, the high volume of distribution probably imparts the half-life observed. Importantly, no toxicity or abnormal behavior were detected. We have recently performed a maximum tolerated PO administration) dose study on C57/Bl6 mice (5 day with 5 day post-dosing observation), with no mortality observed at 90, 300, and 3000 mg/kg (see supplementary material). No obvious abnormalities were noted post-necropsy in any of the in vivo mammalian studies.

Table 6.

Pharmacokinetic Parameters for Compound 65 in Male C57/Bl6 Mice

Route	Dosing Level (mg/kg)	CL obsa (mL/min/kg)	t1/2b(h)	C0c (μg/mL)	Cmaxd (μg/L)	AUClaste (μg-h/mL)	AUCinff (μg-h/mL)	MRTlastg (h)	Vss obsh (L/kg)	Fi (%)
IV (plasma)	3	67.2	6.6	0.49	ND	0.70	0.74	4.4	24.5	ND
PO (plasma)	30	ND	5.5	ND	0.30	0.98	1.00	3.1	ND	14
IV (heart)	3	8.78	6.3	2.93	ND	5.19	5.69	5.5	4.2	ND
PO (heart)	30	ND	1.0	ND	1.03	2.63	2.68	2.2	ND	ND

^aTotal clearance after IV administration

^bHalf-life

^cConcentration

^dMaximum serum concentration

^eArea under the curve

^fArea under the curve

^gMean residense time

^hVolume of distribution in steady state

ⁱBioavailability

Previously described antifibrotic effects of relaxin in various organs were associated with changes in transcriptional activity of key genes involved in extracellular matrix production and turnover.²⁴ In fibrotic liver, hepatic stellate cells (HSCs) become activated and differentiate into profibrogenic myofibroblast-like cells. Importantly, RXFP1 gene expression is significantly upregulated in activated HSCs.²⁵ It has been shown that relaxin treatment of activated HSCs leads to a significant decrease in profibrotic genes such as smooth muscle actin (ACTA2), transforming growth factor beta-1 (TGFB1), connective tissue growth factor (CTGF), and several collagens, but at the same time stimulates expression of matrix metalloproteinase 1 (MMP1) and peroxisome proliferator-activated receptor gamma (PPARG).^26,27

Therefore, we have tested the effect of ML290 on primary human HSC gene expression (Figure 3). Cells were cultured on plastic, which induces and maintains activation of HSCs.²⁸ Upon treatment with 5μM of ML290, we observed a clear anti-fibrotic, relaxin-like gene expression pattern at 24 and 72 hr. Similar results have been recently reported by another group in the HSC LX-2 cell line using ML-290.²⁹

Figure 3.

ML290 activates an antifibrotic gene expression profile in activated human hepatic stellate cells. HSCs were treated with 5μM of ML290 or DMSO for 24 and 72 hr. Gene expression was evaluated by quantitative RT-PCR, normalized to GAPDH gene expression and presented as the fold change vs DMSO-treated control. N=3, *p < 0.05, **p < 0.01.

CONCLUSION

Optimization of two lead compounds discovered by an extensive screening campaign of over 350,000 compounds at the National Center for the Advancement of Translational Science resulted in a series of potent, stable, selective and well-tolerated compounds which exhibit excellent systemic exposure in plasma and especially heart.

To summarize the SAR of the compounds presented here, the core aromatic ring must be ortho substituted to maintain activity. Replacing the central phenyl ring with either a thiophene or pyridine is tolerated although a decrease in activity is observed. The western hemisphere amide is critical for the activity.

For the western region, phenyl, pyridine and cycloalkanes of varying ring size are acceptable, but a six membered ring is optimal. An electron-donating substituent on the aromatic ring is tolerated at both the ortho- and meta-positions, with ortho-alkoxy having the best activity. At the eastern phenyl position, a meta-substitution is optimal and the trifluoromethylsulfonyl is best as a critical hydrogen bond interaction is formed between the sulfonyl oxygens and threonine 660.

Thus, the first small-molecule preclinical candidate agonist for the relaxin hormone receptor has been optimized through a medicinal chemistry approach and the resulting SAR is supported by a later-stage binding model obtained by iterative site-directed mutagenesis.

EXPERIMENTAL SECTION

Biology

Materials and Methods

Primary human hepatic stellate cells (HSCs) were grown on plastic in hepatic stellate growth media provided by the manufacturer (Zen-Bio Inc., Research Triangle Park, NC). Cells were seeded overnight in 35 mm poly-L-lysine-coated dishes (Corning, Durham, NC) at a density of 5×10⁴ cells per dish and treated in triplicates with either 5μM of ML290 in DMSO (ML290 treatment) or DMSO (control) for 24 or 72 hr. Total RNA was extracted from cells samples with RNeasy kit (Qiagen, Germantown, MD). Quality and concentration of RNA was analyzed with a Nanovue (GE Healthcare Biosciences, Pittsburgh, PA). cDNA was synthesized using a Verso cDNA kit (Thermo Scientific, Fair Lawn, NJ). Quantitative PCR (qPCR) was performed using GoTaq qPCR Master Mix (Promega, Madison, WI), and gene specific primers in a RealPlex² Mastercycler (Eppendorf, Westbury, NY) according to the manufacturer’s instructions. Values were normalized to GAPDH gene expression. The relative fold change in mRNA level was calculated by the comparative C_t (2^{−ΔΔC t}) method. Results were analyzed using GraphPad Prism software (GraphPad Software, La Jolla, CA) for statistical significance using Student’s t test.

Measurements of cAMP concentration

cAMP assay was performed using HTRF cAMP HiRange kit (CisBio, Bedford, MA, USA). The THP1 and HEK293 cells (ATCC, Manassas, VA, USA) stably or transiently transfected with human RXFP1, RXFP2 or AVPR1B receptor were stimulated with relaxin, the compounds or forskolin for 30 min at 37 °C, 5% CO₂, after which, 8 ml per well of each HTRF detection reagent (diluted according to assay kit directions in HTRF lysis buffer) was added.^30,31 The plates were incubated for 30 min at room temperature, and the signal was read on a ViewLux (Perki-nElmer, Waltham, MA, USA) or a FLUOstar Omega (BMG Labtech, Cary, NC, USA) plate readers. Nonlinear regressions to the Hill equation were performed using Prism software (GraphPad Software, San Diego, CA, USA).

Modulation of HSC gene expression

Primary human hepatic stellate cells (HSCs) were grown on plastic in hepatic stellate growth media provided by the manufacturer (Zen-Bio Inc., Research Triangle Park, NC). Cells were seeded overnight in 35 mm poly-L-lysine-coated dishes (Corning, Durham, NC) at a density of 5×104 cells per dish and treated in triplicates with either 5μM of ML290 in DMSO (ML290 treatment) or DMSO (control) for 24 or 72 hr. Total RNA was extracted from cells samples with RNeasy kit (Qiagen, Germantown, MD). Quality and concentration of RNA was analyzed with a Nanovue (GE Healthcare Biosciences, Pittsburgh, PA). cDNA was synthesized using a Verso cDNA kit (Thermo Scientific, Fair Lawn, NJ). Quantitative PCR (qPCR) was performed using GoTaq qPCR Master Mix (Promega, Madison, WI), and gene specific primers in a RealPlex2 Mastercycler (Eppendorf, Westbury, NY) according to the manufacturer’s instructions. Values were normalized to GAPDH gene expression. The relative fold change in mRNA level was calculated by the comparative Ct (2–ΔΔCt) method. Results were analyzed using GraphPad Prism software (GraphPad Software, La Jolla, CA) for statistical significance using Student’s t test. The sequences of the primers are shown in Table 7.

Table 7.

Primer sequences used in qPCR.

Gene	Forward primer	Reverse primer
GAPDHa	AGCCACATCGCTCAGACAC	GCCCAATACGACCAAATCCc
ACTA2b	AAGCACAGAGCAAAAGAGGAAT	ATGTCGTCCCAGTTGGTGAT
COL1A1c	AGACAGTGATTGAATACAAAACCA	GGAGTTTACAGGAAGCAGACA
CTGFd	CCCAGACCCAACTATGATTAGAG	AGGCGTTGTCATTGGTAACC
MMP1e	GCACTGAGAAAGAAGACAAAGG	CTAAGTCCACATCTTGCTCTTG
MMP2f	CATACAGGATCATTGGCTACAC	TCACATCGCTCCAGACTTG
PPARGC1Ag	ATAAATCACACGGCGCTCTT	TGAGAGGGCCAAGCAAAG
TGFB1h	CACTCCCACTCCCTCTCTC	GTCCCCTGTGCCTTGATG

^aGlyceraldehyde-3-phosphate dehydrogenase

^bAlpha-acti-2

^cCollagen

^dConnective tissue growth factor

^eMatrix metallopeptidase 1

^fMatrix metallopeptidase2

^gPeroxisome proliferative activated receptor, gamma, coactivator 1 alpha

^hVolume of distribution in steady state

ⁱTransforming growth factor beta-1

Chemistry

General Methods

All air or moisture sensitive reactions were performed under positive pressure of nitrogen with oven-dried glassware. Anhydrous solvents such as dichloromethane, N, N-dimethylformamide (DMF), acetonitrile, methanol and tetrahydrofuran were purchased from Sigma-Aldrich (St. Louis, Mo.). Preparative purification was performed on a Waters semi-preparative HPLC system (Waters Corp., Milford, Mass.). The column used was a Phenomenex Luna C18 (5 micron, 30 × 75 mm; Phenomenex, Inc., Torrance, Calif.) at a flow rate of 45.0 mL/min. The mobile phase consisted of acetonitrile and water (each containing 0.1% trifluoroacetic acid). A gradient of 10% to 50% acetonitrile over 8 minutes was used during the purification. Fraction collection was triggered by UV detection at 220 nM. Analytical analysis was performed on an Agilent LC/MS (Agilent Technologies, Santa Clara, Calif.). Method 1 (t₁): A 7-minute gradient of 4% to 100% acetonitrile (containing 0.025% trifluoroacetic acid) in water (containing 0.05% trifluoroacetic acid) was used with an 8-minute run time at a flow rate of 1.0 mL/min. Method 2 (t₂): A 3-minute gradient of 4% to 100% acetonitrile (containing 0.025% trifluoroacetic acid) in water (containing 0.05% trifluoroacetic acid) was used with a 4.5-minute run time at a flow rate of 1.0 mL/min. A Phenomenex Luna C18 column (3 micron, 3 × 75 mm) was used at a temperature of 50 °C. Purity determination was performed using an Agilent diode array detector for both Method 1 and Method 2. Mass determination was performed using an Agilent 6130 mass spectrometer with electrospray ionization in positive detection mode. ¹H NMR spectra were recorded on Varian 400 MHz spectrometers (Agilent Technologies, Santa Clara, Calif.). Chemical shifts are reported in ppm with undeuterated solvent (DMSO-d₆ at 2.49 ppm) as internal standard for DMSO-d₆ solutions. All of the analogs tested in the biological assays have a purity of greater than 95% based on both analytical methods. High resolution mass spectrometry was recorded on Agilent 6210 Time-of-Flight (TOP) LC/MS system. Confirmation of molecular formula was accomplished using electrospray ionization in the positive mode with Agilent Masshunter software (Version B.02).

General Protocol A

A solution of methyl or ethyl benzoate (0.191 mmol) and amine (0.383 mmol) in toluene (2.00 mL) was treated at room temperature with AlMe₃ (0.192 mL, 2.0 M in toluene, 0.384 mmol). The reaction mixture was stirred overnight at 100° C and then quenched with 100 μL of water. The mixture was concentrated, redissolved in 2.00 mL of DMSO, filtered and purified via C18 reverse phase HPLC to give the final product.

General Protocol B

A solution of carboxylic acid (0.178 mmol) in DMF (2.00 mL) was treated at room temperature with 2-amino-N-(3-(trifluoromethyl)pheny1)benzamide (25.0 mg, 0.089 mmol) followed by EDC (17.l mg 0.089 mmol) and DMAP (10.9 mg, 0.089 mnol). The reaction mixture was stirred overnight at room temperature. The mixture was purified via C18 reverse phase HPLC to give the final product.

General Protocol C

A solution of 2-amino-N-(3- (trifluoromethyl)phenyl)benzamide (50.0 mg, 0.178 mmol) in dichloromethane (2.00 mL) and TEA (0.075 mL, 0.535 mmol) was treated at room temperature with carbonyl chloride (0.357 mmol). The reaction mixture was stirred at room temperature for 2 h. The mixture was concentrated, re-dissolved in 2.00 mL of DMSO, filtered and purified via C18 reverse phase HPLC to give the final product.

General Protocol D

A solution of carboxylic acid (0.357 mmol) in DMF (2.00 mL) was added DIPEA (0.093 mL, 0.535 mmol) and HATU (136 mg, 0.357 mmol). The reaction mixture was stirred at room temperature for 5 min, followed by 2-amino-N-(3-(trifluoromethyl)-phenyl)benzamide (50.0 mg, 0.178 mmol). The reaction mixture was stirred overnight at room temperature, filtered and purified via C18 reverse phase HPLC to give the final product.

General Protocol E

A mixture of 2-bromo-N-(3- (trifluoromethyl)phenyl)benzamide (50.0 mg, 0.145 mmol, 1.0 equiv.) or N-(3-bromophenyl)-2-(cyclohexanecarboxamido)benzamide (100 mg, 0.249 mmol, 1.0 equiv.), boronic acid or pinacol ester (2.0 equiv.) and Pd(PPh₃)₄ (0.05 eq) in DMF (1.50 mL) and 2.0 N Na₂CO₃ (0.50 mL) aqueous solution was heated in μW at 100° C for 30 min to 1 h. The reaction was cooled to room temperature, and a small portion of Si-THIOL was added to remove palladium. The reaction mixture was filtered and purified via C18 reverse phase HPLC to give the final product.

General Protocol F

2-Iodo-N-(3-(trifluoromethyl) phenyl)benzamide (100 mg, 0.256 mmol), amine (0.767 mmol), and CuCl (7.59 mg, 0.077 mmol) in DMF (1.00 mL) was stirred at room temperature for 15–30 min. The reaction was treated with a small portion of Si-THIOL to remove palladium, filtered and purified via C18 reverse phase HPLC to give the final product.

General Protocol G

A solution of thio-compound (0.255 mmol) in dichloromethane (3.00 mL) was treated at room temperature with MCPBA (220 mg, 1.27 mmol). The reaction mixture was stirred over-night at room temperature. 10% Aqueous NaHSO₃ solution was added to quench excess MCPBA and the mixture was stirred at room temperature for 15 min. The reaction mixture was partitioned between dichloromethane and water. The organic layer was separated, dried (Na₂SO₄), filtered, concentrated, and purified via C18 reverse phase HPLC to give the final product.

General Protocol H

A tube was charged with CuI (0.1 equiv.), 1,10-phenanthroline (0.2 equiv.), Cs₂CO₃ (2.0 equiv.), iodo substrate (1.0 equiv.) and alcohol (2.0 equiv.) in toluene (2.00 mL) under N₂. The tube was sealed and the reaction mixture was stirred at 110 ° C for 24 h. The resulting mixture was cooled to room temperature and treated with a small portion of Si-THIOL to remove copper. The mixture was concentrated, dissolved in 2.00 mL of DMSO, filtered and purified via C18 reverse phase HPLC to give the final product.

3-(Cyclohexanecarboxamido)-N-(3-(trifluoromethyl)phenyl)-benzamide (3)

The title compound was prepared according to general protocol A. Yield: 35%; LC-MS Retention Time: t₁ (Method 1) = 6.516 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.53 (s, lH), 10.00 (s, lH), 8.21 (t, J = 2.l Hz, lH), 8.14 (t, J = 2.0 Hz, lH), 8.03 (ddd, J = 8.2, 1.2, 1.0 Hz, lH), 7.81 (ddd, J = 8.l, 2.2, 1.1 Hz, lH), 7.55–7.64 (m, 2H), 7.37–7.49 (m, 2H), 2.24–2.41 (m, lH), 1.69–1.92 (m, 4H), 1.57–1.69 (m, lH), 1.08–1.50 (m, 5H); ¹⁹F NMR (376 MHz, DMSO- d₆) δ ppm −61.29 (s, 3F); ¹³C NMR (101 MHz, DMSO-d₆) δ 174.40, 167.65, 140.12, 138.19, 132.20, 130.29, 129.90, 129.58, 129.19, 125.92, 125.07, 124.52, 123.62, 122.48, 120.58, 120.54, 117.14, 117.10, 45.47, 29.45, 25.82, 25.50; HRMS (ESI) m/z (M+H) calcd. for C₂₁H₂₂F₃N₂O₂, 391.1628; found 391.1637.

2-(Cyclohexanecarboxamido)-N-(4-(trifluoromethyl)phenylbenzamide (4)

The title compound was prepared according to general protocol A. Yield; 62%; LC-MS Retention Time: t₁ (Method 1) = 6.943 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.65 (s, lH), 10.29 (s, lH), 8.09 (dd, J =. 8.4, 1.0 Hz, lH), 7.91 (d, J = 8.6 Hz, 2H), 7.74 (dd, J =7.8, 1.4 Hz, lH), 7.71 (d, J = 8.4 Hz, 2H), 7.5l (ddd, J = 8.4, 7.3, 1.6 Hz, lH), 7.21 (td, J =7.6, 1.2 Hz, lH), 2.18–2.35 (m, lH), 1.80 (dd, J =l2.7, 2.9 Hz, 2H), 1.68 (dt, J = l2.2, 3.4 Hz, 2H), 1.59 (d, J = 11.9 Hz, lH), 1.01–1.43 (m, 5H); ¹⁹ FNMR (376 MHz, DMSO-d₆) δ ppm −60.26 (s, 3F); ¹³C NMR (151 MHz, DMSO-d₆) δ 173.94, 167.32, 142.64, 141.12, 137.79, 134.12, 131.86, 131.13, 128.90, 125.96, 123.64, 123.51, 122.03, 120.34, 45.10, 29.02, 25.41, 25.13. HRMS (ESI) m/z (M+H) calcd. For C₂₁H₂₂F₃N₂₀, 391.1628; found 391.1628.

2-(Cyclohexanecarboxamido)-N-phenylbenzamide (5)

The title compound was prepared according to general protocol A. Yield: 68% LC-MS Retention Time: t₁ (Method 1) 6.326 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.54 (s, lH), 10.37 (s, lH), 8.23 (dd, J =8.2, l.0 Hz, lH), 7.77 (dd, J =7.9, l.5 Hz, lH), 7.63–7.71 (m, 2H), 7.49 (ddd, J = 8.4, 7.2, 1.6 Hz, lH), 7.28–7.41(m, 2H), 7.19 (td, J =7.6, 1.3 Hz, lH), 7.07–7.14 (m, lH), 2.17–2.34 (m, lH), 1.76–1.88 (m, 2H), 1.69 (ddd, J = l2.5, 3.4, 3.2 Hz, 2H), l.59 (d, J = 12.l Hz, lH), 1.03–1.43 (m, 5H); ¹³C NMR (151 MHz, DMSO-d₆) δ 176.98, 170.13, 141.77, 141.35, 134.88, 131.88, 131.73, 127.14, 126.60, 125.99, 124.48, 123.91, 48.42, 43.00, 42.86, 42.72, 42.58, 42.44, 42.30, 42.16, 32.14, 28.48, 28.20; HRMS (ESI) m/z (M+H) calcd. For C₂₀H₂₃N₂O₂, 323.l754; found 323.l758.

2-(Cyclohexanecarboxamido)-N-o-tolylbenzamide (6)

The title compound was prepared according to general protocol A. Yield: 38%; LC-MS Retention Time: t₁ (Method 1) = 6.401 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 11.00 (s, lH), 10.09 (s, lH), 8.38 (dd, J = 8.4, 1.2 Hz, lH), 7.91 (d, J = 7.8 Hz, lH), 7.51 (ddd, J =8.6, 7.2, 1.7 Hz, lH), 7.25–7.35 (m, 2H), 7.10–7.25 (m, 3H), 2.21 (s, 3H), 2.16–2.28 (m, lH), 1.77–1.91 (m, 2H), 1.69 (dt, J = l2.4, 3.5 Hz, 2H), l.53–l.65 (m, lH), 0.99–1.44 (m, 5H); ¹³C NMR (101 MHz, DMSO-d₆) δ 173.86, 167.36, 139.15, 135.79, 134.00, 132.11, 130.36, 128.60, 126.87, 126.43, 126.11, 122.63, 121.31, 120.78, 45.61, 29.06, 25.36, 25.06, 17.81; HRMS (ESI) m/z (M+H) calcd. for C₂₁H₂₅N₂O₂, 337.1911; found 337.1912.

2-(Cyclohexanecarboxamido)-N-m-tolylbenzamide (7)

The title compound was prepared according to general protocol A. Yield: 55%; LC-MS Retention Time: t₁ (Method 1) = 6.632 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.54 (s, lH), 10.30 (s, lH), 8.24 (dd, J =8.3, 1.1 Hz, lH), 7.76 (dd, J =7.8, 1.4 Hz, lH), 7.38–7.54 (m, 3H), 7.10–7.31 (m, 2H), 6.93 (dddd, J = 7.5, l.5, l.l, 0.8 Hz, lH), 2.29 (s, 3H), 2.19–2.3S (m, lH), 1.82 (dd, J = l2.8, 2.6 Hz, 2H), 1.69 (dt, J = l2.4, 3.4 Hz, 2H), l.S9 (d, J = l2.3 Hz, lH), 1.04–1.42 (m, 5H); ¹³C NMR (101 MHz, DMSO-d₆) δ 173.88, 167.00, 138.53, 138.30, 137.75, 131.75, 128.74, 128.45, 124.76, 123.40, 122.83, 121.39, 121.32, 118.09, 45.33, 29.05, 25.38, 25.07, 21.19; HRMS (ESI) m/z (M+H) calcd. for C₂₁H₂₅N₂O₂, 337.1911; found 337.1908.

2-(Cyclohexanecarboxamido)-N-p-tolylbenzamide (8)

The title compound was prepared according to general protocol A. Yield: 49%; LC-MS Retention Time: t₁ (Method 1) = 6.636 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.61 (s, 1H), 10.30 (s, 1H), 8.26 (dd, J =8.2, 0.8 Hz, 1H), 7.77 (dd, J = 7.8, 1.4 Hz, 1H), 7.52–7.59 (m, 2H), 7.48 (ddd, J =8.4, 7.2, 1.6 Hz, 1H), 7.18(dd, J = 7.8, 1.2 Hz, 1H), 7.11–7.17 (m, 2H), 2.26 (s, 3H), 2.16–2.36 (m, 1H), 1.82 (dd, J = 13.0, 2.1 Hz, 2H), 1.69 (ddd, J =12.2, 3.3, 3.1 Hz, 2H), l.51–1.64 (m, 1H), 1.02–1.47 (m, 5H); ¹³C NMR (101 MHz, DMSO-d₆) δ 174.29, 167.36, 138.85, 136.50, 133.57, 132.20, 129.45, 129.14, 123.60, 123.23, 121.67, 121.37, 45.84, 29.50, 25.83, 25.54, 20.98; HRMS (ESI) m/z (M+H) calcd. for C₂₁H₂₅N₂O₂, 337.1911; found 337.1916.

N-(3-(tert-Butyl)phenyl)-2-(cyclohexanecarboxamido)benzamide (9)

The title compound was pre-pared according to general protocol A. Yield: 80%; LC-MS Retention Time: t₁ (Method 1) = 7.324 min; ¹H NMR (400 MHz, DMSO-d₆) δ 10.51 (s, 1H), 10.30 (s, 1H), 8.20 (d, J = 8.3 Hz, 1H), 7.77 (d, J = 7.7 Hz, 1H), 7.61 (d, J = 8.4 Hz, 2H), 7.54 – 7.45 (m, 1H), 7.27 (dd, J = 8.3, 7.6 Hz, 1H), 7.24 – 7.11 (m, 2H), 2.30 – 2.20 (m, 1H), 1.91 – 1.79 (m, 2H), 1.69 (d, J = 12.7 Hz, 3H), 1.60 (d, J = 13.3 Hz, 1H), 1.43 – 1.32 (m, 4H), 1.27 (s, 9H); ¹³C NMR (101 MHz, DMSO-d₆) δ 173.82, 167.22, 140.35, 137.77, 132.75, 131.81, 130.31, 128.73, 124.21, 123.55, 123.04, 121.80, 120.03, 118.95, 45.10, 29.00, 25.37, 25.05, 45.46, 33.89, 30.55, 29.44, 25.82, 25.51; HRMS (ESI) m/z (M+H) calcd. For C₂₄H₃₁N₂O₂, 379.2380; found 379.2387.

2-(Cyclohexanecarboxamido)-N-(3-nitrophenyl)benzamide (10)

The title compound was prepared according to general protocol A. Yield: 30%; LC-MS Retention Time: t₁ (Method 1) = 6.392 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.76 (s, lH), 10.26 (s, lH), 8.69 (t, J = 2.2 Hz, lH), 8.01–8.l5 (m, 2H), 7.95 (ddd, J = 8.3, 2.3, 1.0 Hz, lH), 7.75 (dd, J = 7.8, 1.6 Hz, lH), 7.64 (t, J = 8.2 Hz, lH), 7.46–7.56 (m, lH), 7.22 (td, J = 7.6, 1.2 Hz, lH), 2.19–2.35 (m, lH), 1.79 (dd, J = 12.5, 2.5 Hz, 2H), 1.68 (dt, J = 3.1 Hz, 2H), 1.58 (d, J = 12.5 Hz, lH), 1.03–1.43 (m, 5H); ¹³C NMR (101 MHz, DMSO-δ₆) δ 174.40, 167.74, 148.30, 140.58, 138.17, 132.30, 130.49, 129.23, 126.87, 125.04, 123.66, 122.55, 118.72, 115.03, 45.46, 29.44, 25.82, 25.51; HRMS (ESI) m/z (M+H) calcd. for C₂₀H₂₂N₃O₄, 368.1605; found 368.1616.

2-(Cyclohexanecarboxamido)-N-(3-fluorophenyl)benzamide (11)

The title compound was prepared according to general protocol A. Yield: 73%; LC-MS Retention Time: t₁ (Method 1) = 6.529 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.51 (s, lH), 10.33 (s, lH), 8.12 (dd, J = 8.3, 1.1 Hz, lH), 7.73 (dd, J = 7.7, l.5 Hz, lH), 7.64 (dt, J = ll.7, 2.3 Hz, lH), 7.43–7.55 (m, 2H). 7.37 (td, J = 8.2. 6.7 Hz, lH), 7.20 (td, 7.5, 1.2 Hz, lH), 6.82–6.98 (m, lH), 2.21–2.35 (m, lH), 1.81 (d, J = l1.5 Hz, 2H), 1.69 (dt, J = 12.4, 3.3 Hz, 2H), 1.59 (d, J = 11.7 Hz, lH), 1.02–1.43 (m, 5H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −112.20–112.29 (m, 1F); HRMS (ESI) m/z (M+H) calcd. for C₂₀H₂₂FN₂O₂, 341.1660; found 341.1660.

N-(3-Chlorophenyl)-2-(cyclohexanecarboxamido)benzamide (12)

The title compound was prepared according to general protocol A. Yield: 40%; LC-Retention Time: t₁ (Method 1) = 6.898 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.48 (s, lH), 10.31 (s, lH), 8.11 (d, J = 7.8 Hz, lH), 7.85 (t, J = 2.0 Hz, lH), 7.71(dd, J = 7.7, 1.3 Hz, lH), 7.59 (dd, J = 8.0, 1.8 Hz, lH), 7.43–7.54 (m, lH), 7.35 (t, J = 8.l Hz, lH), 7.06–7.24 (m, 2H), 2.26 (tt, J = 11.3, 3.6 Hz, lH), 1.79 (d, J = 14.l Hz, 2H), 1.68 (ddd, J = 12.7, 3.0, 2.7 Hz, 2H), 1.52–1.62 (m, lH), 1.03–1.41 (m, 5H); ¹³C NMR (101 MHz, DMSO-d₆) δ 173.90, 167.10, 140.30, 137.91, 132.85, 131.77, 130.27, 128.73, 124.17, 123.55, 123.04, 121.80, 120.03, 118.95, 45.10, 29.00, 25.37, 25.05; HRMS (ESI) m/z (M+H) calcd. for C₂₀H₂₂ClN₂O₂, 357.1364; found 357.1366.

N-(3-Bromophenyl)-2-(cyclohexanecarboxamido)benzamide (13)

The title compound was prepared according to general protocol A. Yield: 90%; LC-MS Retention Time: t₁ (Method 1) = 6.904 min; ¹ H NMR (400 MHz, DMSO-d₆) δ ppm 10.47 (s, lH), 10.31 (s, lH), 8.11 (dd, J = 8.4, 1.0 Hz, lH), 7.94–8.04 (m, lH), 7.72 (dd, J = 7.8, 1.6 Hz, lH), 7.64 (ddd, J = 6.7, 2.3, 2.2 Hz, lH), 7.49(ddd, J = 8.4, 7.2, 1.6 Hz, lH), 7.24–7.35 (m, 2H), 7.19 (td, J = 7.6, 1.2 Hz, lH), 2.21–2.37 (m, lH), 1.80 (d, J = 11.5 Hz, 2H), 1.69 (dt, J = l2.2, 3.2 Hz, 2H). l.59 (d, J = 12.5 Hz, lH), 1.07–1.42 (m, 5H); ¹³C NMR (151 MHz, DMSO-d₆) δ 177.00, 170.14, 143.70, 141.05, 134.85, 133.69, 131.84, 129.67, 129.53, 127.55, 126.17, 125.07, 124.93, 122.38, 48.30, 32.24, 28.61, 28.29; HRMS (ESI) m/z (M+H) calcd. for C₂₀H₂₂BrN₂O₂, 401.0859; found 401.0859.

2-(Cyclohexanecarboxamido)-N-(3-methoxyphenyl)benzamide (14)

The title compound was pre-pared according to general protocol A. Yield: 47%; LC-MS Retention Time: t₁ (Method 1) = 6.344 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.47 (s, lH), 10.33 (s, lH), 8.20 (dd, J = 8.4, 1.0 Hz, lH), 7.74 (dd, J = 7.8, 1.4 Hz, lH), 7.49 (ddd, J = 8.4, 7.2, 1.6 Hz, lH), 7.33 (t, J = 2.2 Hz, lH), 7.13–7.30 (m, 3H), 6.69 (ddd, J = 7.8, 2.5, 1.4 Hz, lH), 3.73 (s, 3H), 2.26 (tt, J =11.3, 3.6 Hz, lH), 1.82 (dd, J = 12.5, 2.7 Hz, 2H), 1.69 (ddd, J = 12.4, 3.1, 2.8 Hz, 2H), l.5l–1.64 (m, 1H), 1.02–1.41 (m, 5H); ¹³C NMR (101 MHz, DMSO-d₆) δ 174.31, 167.47, 159.82, 140.28, 138.58, 132.17, 129.84, 129.16, 124.20, 123.34, 121.95, 113.48, 109.81, 107.12, 55.49, 45.72, 29.48, 25.83, 25.53; HRMS (ESI) m/z (M+H) calcd. for C₂₁H₂₅N₂O₃, 353.1860; found 353.1856.

2-(Cyclohexanecarboxamido)-N-(3-(methylthio)phenyl)benzamide (15)

The title compound was prepared according to general protocol A. Yield: 36%; LC-MS Retention Time: t₁₁ (Method 1) = 6.687 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.44 (s, lH), 10.37 (s, lH), 8.18 (d, J = 8.2 Hz, lH), 7.75 (dd, J = 7.8, 1.6 Hz, lH), 7.63 (t, J = 2.l Hz, lH), 7.44–7.55 (m, 2H), 7.29 (t, J = 7.9 Hz, lH), 7.20 (td, J = 7.6, 1.3 Hz, lH), 7.01 (ddd, J = 7.8, 2.0, 1.0 Hz, lH), 2.46 (s, 3H), 2.19–2.35 (m, lH), 1.76–1.90 (m, 2H), 1.65–1.76 (m, 2H), 1.52–1.65 (m, lH), 1.03–1.47 (m, 5H); ¹³C NMR (101 MHz, DMSO-d₆) δ 173.89, 167.05, 139.25, 138.41, 138.08, 131.74, 129.12, 128.70, 123.86, 122.95, 121.60, 121.35, 117.88, 117.23, 45.23, 29.04, 25.38, 25.08, 14.67; HRMS (ESI) m/z (M+H) calcd. for C₂₁H₂₅N₂O₂S, 369.1631; found 369.1625.

2-(Cyclohexanecarboxamido)-N-(3-(trifluoromethyl)phenyl)benzamide (16)

The title compound was prepared according to general protocol A. Yield: 50%; LC-MS Retention Time: t₁ (Method 1) = 7.349 min; ¹H NMR (600 MHz, DMSO-d₆) δ 10.58 (s, 1H), 10.28 (s, 1H), 8.12 (d, J = 2.0 Hz, 1H), 8.04 (d, J = 8.2 Hz, 1H), 7.90 (ddd, J = 8.3, 2.2, 1.1 Hz, 1H), 7.72 (dd, J = 7.8, 1.6 Hz, 1H), 7.50 (q, J = 7.2, 6.5 Hz, 2H), 7.43 (dt, J = 7.9, 1.3 Hz, 1H), 7.21 (td, J = 7.6, 1.2 Hz, 1H), 2.26 (tt, J = 11.5, 3.6 Hz, 1H), 1.82 – 1.75 (m, 2H), 1.67 (dt, J = 12.9, 3.5 Hz, 2H), 1.58 (dt, J = 13.0, 3.4 Hz, 1H), 1.37 – 1.17 (m, 5H), 1.11 (dddd, J = 16.1, 12.4, 7.9, 3.5 Hz, 1H), 1.02 (s, 2H); ¹³C NMR (151 MHz, DMSO-d₆) δ 177.05, 170.21, 143.28, 140.76, 134.83, 134.25, 133.79, 133.33, 131.88, 131.75, 130.35, 127.94, 126.33, 126.18, 125.19, 48.41, 32.09, 28.48, 28.18; HRMS (ESI) m/z (M+H) calcd. for C₂₁H₂₂F₃N₂O₂S, 423.1349; found 423.1360.

2-(Cyclohexanecarboxamido)-N-(3((trifluoromethyl)sulfonyl)phenyl)benzamide (17)

The title compound was prepared according to general protocol G. Yield: 80%; LC-MS Retention Time: t₁ (Method 1) = 6.964 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.83 (s, lH), 10.16 (s, lH), 8.57 (t, J =l.6 Hz, lH), 8.26 (ddd, J = 5.7, 3.7, 2.2 Hz, lH), 7.93 (dd, J = 8.3, 1.3 Hz, lH), 7.76–7.86 (m, 2H), 7.72 (dd, J = 7.8, 1.6 Hz, lH), 7.52 (ddd, J = 8.5, 7.2, 1.6 Hz, lH), 7.23 (td, J = 7.6, 1.2 Hz, lH), 2.16–2.36 (m, lH), 1.73–1.87 (m, 2H), 1.62–1.73 (m, 2H), 1.50–1.62 (m, lH), 0.82–1.46 (m, 5H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −78.42 (s, 3F); ¹³C NMR (151 MHz, DMSO-d₆) δ 174.04, 167.31, 141.09, 137.28, 131.77, 131.30, 129.82, 128.79, 128.47, 125.80, 125.24, 123.52, 122.71, 122.61, 120.99, 120.55, 118.38, 116.22, 44.85, 29.00, 25.42, 25.11; HRMS (ESI) m/z (M+H) calcd. for C₂₁H₂₂F₃N₂O₄S, 455.1247; found 455.1253.

N-([1,1′-Biphenyl]-3-yl)-2-(cyclohexanecarboxamido) benzamide (18)

The title compound was pre-pared according to general protocol A. Yield: 39%; LC-MS Retention Time: t₁ (Method 1) = 7.181 min; ¹H NMR (600 MHz, DMSO-d₆) δ 10.51 (d, J = 13.2 Hz, 2H), 8.22 (dd, J = 8.4, 1.1 Hz, 1H), 8.00 (t, J = 2.0 Hz, 1H), 7.82 (dd, J = 7.9, 1.6 Hz, 1H), 7.73 (dt, J = 8.0, 1.6 Hz, 1H), 7.67 – 7.61 (m, 2H), 7.56 – 7.36 (m, 6H), 7.23 (td, J = 7.6, 1.2 Hz, 1H), 2.29 (tt, J = 11.5, 3.6 Hz, 1H), 1.88 – 1.81 (m, 2H), 1.71 (dp, J = 10.7, 3.5 Hz, 2H), 1.64 – 1.57 (m, 1H), 1.37 (qd, J = 12.5, 3.3 Hz, 2H), 1.26 (qt, J = 12.6, 3.3 Hz, 2H), 1.15 (qt, J = 12.5, 3.5 Hz, 1H); ¹³C NMR (151 MHz, DMSO-d₆) δ 177.02, 170.21, 143.70, 143.15, 142.36, 141.23, 134.87, 132.36, 132.11, 131.85, 130.73, 129.72, 126.97, 126.08, 125.49, 124.68, 122.92, 122.25, 48.36, 32.16, 28.48, 28.18; HRMS (ESI) m/z (M+H) calcd. for C₂₆H₂₇N₂O₂, 399.2067; found 399.2071.

2-(Cyclohexanecarboxamido)-N-(2′-(trifluoromethyl)-[1, l′-biphenyl]-3- yl)benzamide (19)

The title compound was prepared according to general protocol E. Yield: 25%; LC-MS Retention Time: t₁ (Method 1) = 7.417 min; ¹H NMR (600 MHz, DMSO-d₆) δ 10.50 (s, 1H), 10.41 (s, 1H), 8.16 (dd, J = 8.2, 1.1 Hz, 1H), 7.85 (dd, J = 7.9, 1.2 Hz, 1H), 7.82 – 7.71 (m, 4H), 7.63 (td, J = 7.6, 1.1 Hz, 1H), 7.51 (ddd, J = 8.6, 7.4, 1.6 Hz, 1H), 7.43 (t, J = 7.9 Hz, 2H), 7.22 (td, J = 7.6, 1.2 Hz, 1H), 7.07 (dd, J = 7.5, 1.6 Hz, 1H), 2.28 (tt, J = 11.4, 3.5 Hz, 1H), 1.82 (dd, J = 12.9, 3.5 Hz, 2H), 1.69 (dp, J = 10.6, 3.2 Hz, 2H), 1.60 (dtt, J = 12.7, 3.4, 1.5 Hz, 1H), 1.35 (qd, J = 12.5, 3.2 Hz, 2H), 1.25 (qt, J = 12.6, 3.3 Hz, 2H), 1.14 (qt, J = 12.5, 3.5 Hz, 1H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −55.34 (s, 3F); ¹³C NMR (151 MHz, DMSO-d₆) δ 173.96, 167.09, 140.54, 139.69, 138.49, 137.97, 132.37, 132.08, 131.72, 128.81, 128.29, 128.20, 126.92, 126.73, 126.10, 125.10, 124.27, 123.29, 123.09, 121.78, 120.66, 119.82, 45.20, 29.05, 25.40, 25.10; HRMS (ESI) m/z (M+H) calcd. for C₂₇H₂₆F₃N₂O₂, 467.1941; found 467.1931.

2-(Cyclohexanecarboxamido)-N-(3′-(trifluoromethyl)-[1,1′-biphenyl]-3-yl)benzamide (20)

A mixture of N-(3-bromophenyl)-2-(cyclohexanecarboxamido)benzamide (50.0 mg, 0.125 mmol), 3-(trifluoromethyl)phenylboronic acid (35.5 mg, 0.187 mmol) and Pd(PPh₃)₄ (7.2 mg, 6.23 μmol) in DMF (l.50 mL) and 2.0 N Na₂CO₃ (0.50 mL) aqueous solution was heated in μW at 100 °C for 30 min. The reaction was cooled to room temperature, a small portion of Si-THIOL was added to remove palladium. The mixture was filtered and purified via C18 reverse phase HPLC to give the 35 mg (70% yield) of product. LC-MS Retention Time: t₁ (Method 1) = 7.438 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.50 (br s, 1H), 10.49 (s, 1H), 8.14–8.24 (m, 1H), 8.01–8.08 (m, 1H), 7.94–8.01 (m, 1H), 7.91 (s, 1H), 7.78–7.84 (m, 2H), 7.70–7.77 (m, 2H), 7.41–7.56 (m, 3H), 7.22 (td, J = 7.6, 1.3 Hz, lH), 2.21–2.35 (m, lH), 1.83 (d, J =l5.8 Hz, 2H), 1.64–1.74 (m, 2H), 1.52–1.63 (m, 1H), 1.08–1.46 (m, 5H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.11 (s, 3F); ¹³C NMR (151 MHz, DMSO-d₆) δ 173.12, 167.66, 142.23, 139.78, 139.54, 137.09, 135.78, 132.21, 131.29, 129.51, 129.48, 127.76, 127.72, 126.89, 126.84, 124.47, 124.22, 123.65, 122.98, 120.51, 119.86, 43.09, 29.23, 25.11, 24.84; HRMS (ESI) m/z (M+H) calcd. for C₂₇H₂₆F₃N₂O₂, 467.1941; found 467.1943.

2-(Cyclohexanecarboxamido)-N-(3-(trifluoromethyl)benzyl)benzamide (21)

The title compound was prepared according to general protocol A. Yield: 71%; LC-MS Retention Time: t₁ (Method 1) = 6.781 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 11.13 (s, lH), 9.34 (t, J = 6.l Hz, lH), 8.37 (dd, J = 8.4, 1.4 Hz, lH), 7.76 (dd, J = 7.9, 1.7 Hz, lH), 7.66–7.70 (m. lH), 7.58–7.66 (m. 2H), 7.53–7.58 (m, lH), 7.47 (ddd, J = 8.5, 7.2, 1.7 Hz, lH), 7.13 (td, J = 7.6, 1.3 Hz, lH), 4.54 (d, J = 5.9 Hz, 2H), 2.20 (tt, J = l.12, 3.5 lH), 1.75–1.87 (m, 2H), 1.68 (dt, J = 12.3, 3.2 Hz, 2H), 1.53–1.64 (m, lH), 1.02–1.42 (m, 5H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.02 (s, 3F); ¹³C NMR (101 MHz, DMSO-d₆) δ 173.76, 168.56, 140.60, 139.05, 132.02, 131.43, 129.40, 129.17, 128.86, 128.01, 123.82, 123.78, 123.64, 123.60, 122.54, 120.71, 120.59, 45.69, 42.25, 29.03, 25.35, 25.07; HRMS (ESI) m/z (M+H) calcd. for C₂₂H₂₄F₃N₂O₂, 405.1784; found 405.1790.

2-(Cyclohexanecarboxamido)-N-(furan-2-yl-methyl)benzamide (22)

The title compound was prepared according to general protocol A. Yield: 42%; LC-MS Retention Time: t₁ (Method 1) = 6.799 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 12.07 (s, 1H), 10.69 (s, 1H), 9.29 (t, J = 5.8 Hz, 1H), 8.41 (dd, J = 8.3, 1.3 Hz, 1H), 8.22 (dd, J = 8.3, 1.3 Hz, 1H), 7.80 (dd, J = 8.0, 1.6 Hz, 1H), 7.73 (dd, J = 7.8, 1.6 Hz, 1H), 7.45–7.64 (m, 3H), 7.13–7.29 (m, 2H), 6.36 (dd, J = 3.2, 1.9 Hz, 1H), 6.22–6.33 (m, 1H), 4.45 (d, J = 5.5 Hz, 2H), 2.18–2.36 (m, 1H), 1.76–1.91 (m, 2H), 1.64–1.76 (m, 2H), 1.50–1.64 (m, 1H), 1.05–1.44 (m, 5H); ¹³C NMR (101 MHz, DMSO-d₆) δ 174.40, 168.70, 166.89, 152.14, 142.57, 139.06, 138.97, 132.64, 132.60, 128.73, 128.13, 123.82, 122.10, 121.79, 121.73, 110.92, 107.51, 45.81, 36.52, 29.41, 25.82, 25.53; HRMS (ESI) m/z (M+H) calcd. for C₂₆H₂₈N₃O₄, 446.2074; found 446.2080.

2-Iodo-N-(2-((3-(trifluoromethy1)phenyl)carbamoyl)pheny1)benzamide (24b)

The title compound was prepared according to general protocol C. Yield: 89%; LC-MS Retention Time: t₁ (Method 1) = 6.879 min; ¹H NMR (400 MHz, DMSO-d₆) δ 10.79 (s, 1H), 10.74 (s, 1H), 8.19 – 8.07 (m, 2H), 8.02 – 7.90 (m, 2H), 7.83 (dd, J = 7.8, 1.5 Hz, 1H), 7.67 – 7.41 (m, 5H), 7.34 (td, J = 7.6, 1.2 Hz, 1H), 7.23 (ddd, J = 7.9, 7.1, 2.0 Hz, 1H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ −61.29 (s, 3F); ¹³C NMR (101 MHz, DMSO-d₆) δ 167.10, 166.99, 142.26, 139.72, 139.42, 136.99, 131.84, 131.43, 129.83, 129.44, 129.13, 128.93, 128.24, 128.00, 125.64, 124.16, 123.99, 122.75, 122.45, 120.09, 116.59, 116.55, 93.28; HRMS (ESI) m/z (M+H) calcd. for C₂₁H₁₅F₃N₂O₂, 511.0125; found 511.0122.

2-(2-Ethylbutanamido)-N-(3-(trifluoromethyl)phenyl)benzamide (25)

The title compound was pre-pared according to general protocol C. Yield: 12%; LC-MS Retention Time: t₁ (Method 1) = 6.751 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.60 (s, lH), 10.25 (s, lH), 8.15 (t, J = 2.2 Hz, lH), 7.98 (dd, J = 8.2, 1.4 Hz, lH), 7.93 (ddd, J =8.2, 1.2, 1.0 Hz, 1H), 7.72 (dd, J = 7.7, 1.7 Hz, 1H), 7.57 (t, J = 7.9 Hz, lH), 7.50 (ddd, J = 8.4, 7.1, 1.7 Hz, lH), 7.38–7.47 (m, lH), 7.23 (td, J = 7.6, 1.3 Hz, 1H), 2.15 (tt, J = 8.8, 5.4 Hz, lH), 1.30–1.62 (m, 4H), 0.74–0.86 (m, 6H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.23 (s, 3F); ¹³C NMR (151 MHz, DMSO-d₆) δ 176.94, 170.24, 142.91, 140.15, 134.62, 132.92, 132.47, 132.26, 131.68, 129.09, 128.15, 126.93, 126.67, 126.34, 125.82, 123.11, 123.09, 123.06, 119.56, 119.53, 119.50, 53.43, 28.26, 14.82; HRMS (ESI) m/z (M+H) calcd. for C₂₀H₂₂F₃N₂O₂, 379.1628; found 379.1634.

2-Pentanamido-N-(3-(trifluoromethyl)phenyl)benzamide (26)

The title compound was prepared according to general protocol C. Yield: 22%; LC-MS Retention Time: t₁ (Method 1) = 6.546 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.61 (s, lH), 10.19 (s, lH), 8.17 (t, J = 2.2 Hz, lH), 7.98 (dd, J =8.l, 1.1 Hz, lH), 7.92 (ddd, J = 8.2, 2.0, 0.8 Hz, lH), 7.71 (dd, J = 7.7, 1.7 Hz, lH), 7.57 (t, J =8.l Hz, 1H), 7.47–7.54 (m, lH), 7.39–7.47 (m, 1H), 7.21 (td, J = 7.6, 1.3 Hz, lH), 2.28 (t, J = 7.4 Hz, 2H), 1.43–1.60 (m, 2H), 1.18–1.34 (m, 2H), 0.80 (t, J = 7.6 Hz, 3H); ¹⁹F NMR (376 MHz, DMSO-d₆) d ppm −61.21 (s, 3F); ³C NMR (101 MHz, DMSO-d₆) δ 171.63, 167.56, 140.24, 137.76, 132.01, 130.23, 129.90, 129.59, 129.08, 125.93, 124.35, 123.79, 122.82, 120.49, 116.95, 116.91, 36.83, 27.59, 22.10, 14.08; HRMS (ESI) m/z (M+H) calcd. for C₁₉H₂₀F₃N₂O₂, 365.1471; found 365.1476.

2-(Cyclopropanecarboxamido)-N-(3-(trifluoromethyl)phenyl)benzamide (27)

The title compound was prepared according to general protocol B. Yield: 51%; LC-MS Retention Time: t₁ (Method 1) = 6.131 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.61 (s, lH), 10.46 (s, lH), 8.17 (s, lH), 7.95–8.08 (m, lH), 7.91 (dd, J = 7.9, 1.3 Hz, lH), 7.71 (dd, J = 7.9, 1.5 Hz, lH), 7.57 (t, J = 7.9 Hz, lH), 7.46–7.53 (m, lH), 7.40–7.46 (m, lH), 7.20 (tt, J = 7.6, 0.8 Hz, lH), 1.61–1.81 (m, lH), 0.65–0.79 (m, 4H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.28 (s, 3F); ¹³C NMR (101 MHz, DMSO-d₆) δ 172.12, 167.57, 140.23, 137.84, 132.08, 130.26, 129.90, 129.13, 125.54, 124.42, 123.69, 122.71, 120.53, 117.02, 116.98, 15.48, 7.85; HRMS (ESI) m/z (M+H) calcd. for C₁₈H₁₆F₃N₂O₂, 349.1158; found 349.1160.

2-(Cyclobutanecarboxamido)-N-(3-(trifiuoromethyl)phenyl)benzamide (28)

The title compound was prepared according to general protocol B. Yield: 53%; LC-MS Retention Time: t₁ (Method 1) = 6.412 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.61 (s, lH), 10.22 (s, lH), 8.15 (t, J = 2.2 Hz, lH), 8.09 (dt, J = 8.l, 0.6 Hz, lH), 7.93 (ddd, J = 8.2, 1.2, 1.0 Hz, lH), 7.75 (dd, J = 7.8, 1.6 Hz, 1H), 7.58 (t, J = 7.8 Hz, lH), 7.51 (ddd, J = 8.5, 7.2, 1.6 Hz, 1H), 7.40–7.48 (m, 1H), 7.21 (td, J = 7.6, 1.3 Hz, lH), 3.15–3.26 (m, lH), 2.01–2.24 (m, 4H), 1.80–1.97 (m, 1H), 1.64–1.80 (m, 1H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.18 (s, 3F); ¹³C NMR (101 MHz, DMSO-d₆) δ 172.88, 167.20, 139.68, 137.72, 131.81, 129.83, 129.45, 128.76, 124.03, 123.15, 121.87, 116.61, 39.73, 24.62, 17.51; HRMS (ESI) m/z (M+H) calcd. for C₁₉H₁₈F₃N₂O₂, 363.1315; found 363.1317.

2-(Cyclopentanecarboxamido)-N-(3-(trifluoromcthyl)phenyl)benzamide (29)

The title compound was prepared according to general protocol B. Yield: 76%; LC-MS Retention Time: t₁ (Method 1) = 6.780 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.60 (s, lH), 10.29 (s, lH), 8.15 (t, J = 2.2 Hz, lH), 8.04 (d, J = 7.8 Hz, lH), 7.93 (d, J = 8.4 Hz, lH), 7.73 (dd, J = 7.8, 1.6 Hz, lH), 7.57 (t, J = 7.9 Hz, lH), 7.50 (ddd, J = 8.5, 7.2, 1.6 Hz, lH), 7.44 (d, J = 7.6 Hz, lH), 7.21 (td, J = 7.6, 1.3 Hz, lH), 2.75 (quin, J = 8.0 Hz, lH), 1.74–1.86 (m, 2H), 1.63–1.74 (m, 2H), 1.41–1.63 (m, 4H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.21 (s, 3F); ¹³C NMR (151 MHz, DMSO-d₆) δ 174.82, 174.17, 167.21, 139.81, 139.79, 137.64, 131.74, 129.88, 129.63, 129.42, 129.21, 129.00, 128.77, 126.90, 125.09, 125.03, 123.98, 123.28, 122.15, 121.48, 120.14, 120.12, 120.09, 120.06, 116.61, 116.59, 116.56, 116.53, 45.67, 29.76, 25.53; HRMS (ESI) m/z (M+H) calcd. for C₂₀H₂₀F₃N₂O₂, 377.1471; found 377.1481.

N-(2-((3(Trifiuoromethyl)phenyl)carbamoyl)phenyl)cycloheptanecarboxamide (30)

The title compound was prepared according to general protocol B. Yield: 70%; LC-MS Retention Time: t₁ (Method 1) = 7.093 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.58 (s, lH), 10.18 (s, lH), 8.13 (s, lH), 7.98 (dd, J = 8.l, 0.9 Hz, lH), 7.93 (d, J = 8.0 Hz, lH), 7.71 (dd, J = 7.8, 1.6 Hz, lH), 7.57 (t, J = 7.8 Hz, lH), 7.49 (ddd, J = 8.4, 7.2, 1.6 Hz, lH), 7.39–7.46 (m, lH), 7.21 (td, J =7.6, 1.2 Hz, lH), 2.40–2.51 (m, lH), 1.75–1.88 (m, 2H), 1.31–1.71 (m, lH); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.20 (s, 3F); ¹³C NMR (101 MHz, DMSO-d₆) δ 174.95, 167.10, 139.75, 137.55, 131.58, 129.80, 129.43, 128.66, 125.33, 123.94, 123.25, 122.31, 120.02, 46.58, 40.15, 27.92, 25.83; HRMS (ESI) m/z (M+H) calcd. for C₂₂H₂₄F₃N₂O₂, 405.1784; found 405.1794.

2-(2-Phenylacetamido)-N-(3-(trifluoromethyl)phenyl)benzamide (31)

The title compound was prepared according to general protocol C. Yield: 85%; LC-MS Retention Time: t₁ (Method 1) = 6.443 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.61 (s, lH), 10.30 (s, lH), 8.17 (t, J = 2.l Hz, lH), 8.00–8.07 (m, lH), 7.83–7.91 (m, lH), 7.71 (dd, J = 7.8, 1.6 Hz, lH), 7.57 (t, J = 7.9 Hz, lH), 7.50 (ddd, J = 8.5, 7.2, 1.6 Hz, lH), 7.41–7.47 (m, lH), 7.11–7.34 (m, 6H), 3.66 (s, 2H); ¹⁹F NMR (376 MHz, DMSOd₆) δ ppm −61.15 (s, 3F); ¹³C NMR (101 MHz, DMSO-d₆) δ 169.27, 166.93, 139.70, 137.18, 135.28, 131.61, 129.77, 129.45, 129.35, 129.14, 128.55, 128.28, 126.61, 125.52, 125.26, 123.89, 123.51, 122.81, 122.21, 120.09, 116.42, 43.61; HRMS (ESI) m/z (M+H) calcd. for C₂₂H₁₈F₃N₂O₂, 399.1315; found 399.1312.

N-(2-((3-(Trifiuoromethyl)phenyl)carbamoyl)-phenyl)-nicotinamide (32)

The title compound was prepared according to general protocol C. Yield: 55%; LC-MS Retention Time: t₁ (Method 1) = 5.342 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 11.27 (s, lH), 10.74 (s, lH), 8.95–9.12 (m, lH), 8.67–8.91 (m, lH), 8.19–8.29 (m, lH), 8.17 (dd, J = 8.3, 1.3 Hz, lH), 8.10 (t, J = 2.l Hz, lH), 7.92–8.02 (m, lH), 7.86 (dd, J = 7.8, 1.6 Hz, lH), 7.52–7.69 (m, 3H), 7.38–7.48 (m, lH), 7.33 (td, J = 7.6, 1.4 Hz, lH); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.20 (s, 3F); ¹³C NMR (101 MHz DMSO-d₆) δ 167.23, 163.41, 152.11, 148.03, 139.63, 137.31, 135.43, 132.04, 130.28, 129.88, 129.47, 129.16, 129.03, 125.35, 124.19, 123.94, 122.71, 120.21, 116.75, 116.71; HRMS (ESI) m/z (M+H) calcd. for C₂₀H₁₅F₃N₃O₂, 386.1111; found 386.1116.

2-(4-Methoxybenzamido)-N-(3-((trifluoromethyl)phenyl)benzamide (33)

The title compound was prepared according to general protocol C. Yield: 64%; LC-MS RetentionTime: t₁ (Method 1) = 6.679 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 11.31 (s, lH), 10.75 (s, lH), 8.36 (dd, J = 8.3, 1.3 Hz, lH), 8.08 (t, J = 2.2 Hz, lH), 8.01 (ddd, J = 8.2, 1.2, 1.0 Hz, lH), 7.78–7.92 (m, 3H), 7.54–7.64 (m, 2H), 7.42–7.49 (m, lH), 7.27 (td, J = 7.6, 1.2 Hz, lH), 7.00–7.12 (m, 2H), 3.81 (s, 3H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.25 (s, 3F); ¹³C NMR (101 MHz, DMSO-d₆) δ 167.69, 164.23, 162.19, 139.43, 138.62, 132.31, 129.89, 129.49, 129.17, 129.01, 126.52, 124.48, 123.17, 121.66, 120.41, 117.06, 117.02, 114.07, 55.46, 11.88; HRMS (ESI) m/z (M+H) calcd. for C₂₂H₁₈F₃N₂O₃, 415.1264; found 415.1272.

2-(3-Methoxybenzamido)-N-(3-(trifluoromethyl)phenyl)benzamide (35)

The title compound was prepared according to general protocol C. Yield: 60%; LC-MS Retention Time: t₁ (Method 1) = 6.778 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 11.33 (s, 1H), 10.75 (s, 1H), 8.32 (dd, J = 8.3, 1.3 Hz, 1H), 8.14 (t, J = 2.l Hz, 1H), 7.98 (dt, J = 8.l, 1.2 Hz, 1H), 7.89 (dd, J = 7.9, 1.7 Hz, 1H), 7.52–7.66 (m, 2H), 7.39–7.52 (m, 4H), 7.30 (td, 1.4 Hz, lH), 7.13–7.25 (m, 1H), 3.80 (s, 3H); ¹⁹F NMR (376 MHz, DMSOd₆) δ ppm −61.31 (s, 3F); HRMS (ESI) m/z (M+H) calcd. for C₂₂H₁₈F₃N₂O₃, 415.1264; found 415.1270.

2-Methoxy-N-(2-((3-(trifluoromethyl)phenyl)carbamoyl)phenyl)benzamide (36)

The title compound was prepared according to general protocol C. Yield: 64%. LC-MS RetentionTime: t₁ (Method 1) = 6.734 min; 1H NMR (400 MHz, DMSO-d₆) δ ppm 11.54 (s, lH), 10.84 (s, lH), 8.52–8.63 (m, lH), 8.32 (t, J = 2.2 Hz, lH), 7.94–8.06 (m, 2H), 7.79 (dd, J = 7.7, 1.7 Hz, lH), 7.51–7.68 (m, 3H), 7.43–7.51 (m, lH), 7.24–7.30 (m, lH), 7.17–7.23 (m, lH), 6.99–7.13 (m, lH), 3.97 (s, 3H); ¹⁹F NMR (376 MHz, DMSO-d6) δ ppm −61.40 (s, 3F); ¹³C NMR (101 MHz, DMSO-d₆) δ 167.35, 163.02, 157.16, 139.69, 137.66, 133.68, 131.80, 131.52, 129.99, 129.57, 129.26, 128.57, 124.41, 123.72, 123.13, 121.99, 121.32, 120.86, 120.78, 116.30, 116.25, 112.26, 55.59; HRMS (ESI) m/z (M+H) calcd. for C₂₂H₁₃F₃N₂O₃, 415.1264; found 415.1266.

2-Methyl-N-(2-((3-(trifluoromethyl)phenyl)carbamoyl)phenyl)benzamide (37)

The title compound was prepared according to general protocol C. Yield: 46%; LC-MS Retention Time: t₁ (Method 1) = 6.769 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.74 (s, 1H), 10.70 (s, 1H), 8.08–8.19 (m, 2H), 7.95 (dt, J = 8.2, 1.2 Hz, lH), 7.79 (dd, J = 7.8, 1.8 Hz, 1H), 7.48–7.65 (m, 3H), 7.33–7.47 (m, 2H), 7.22–7.33 (m, 3H), 2.37 (s, 3H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.30 (s, 3F); ¹³C NMR (151 MHz, DMSO-d₆) δ 168.70, 167.24, 139.85, 139.02, 137.32, 136.46, 135.88, 131.81, 131.74, 130.91, 130.60, 130.20, 130.10, 129.62, 129.42, 129.21, 129.05, 128.88, 127.06, 125.86, 123.94, 122.57, 116.50, 21.30; HRMS (ESI) m/z (M+H) calcd. for C₂₂H₁₈F₃N₂O₂, 399.1315; found 399.1324.

2-Chloro-N(2-((3-(trifluoromethyl)phenyl)carbamoyl)phenyl)benzamide (38)

The title compound was prepared according to general protocol C. Yield: 81%; LC-MS Retention Time: t₁ (Method 1) = 6.765 min; ¹H NMR (600 MHz, DMSO-d₆) δ 10.82 (s, 1H), 10.71 (s, 1H), 8.12 (d, J = 2.0 Hz, 1H), 8.06 (d, J = 8.2 Hz, 1H), 7.95 – 7.92 (m, 1H), 7.78 (dd, J = 7.8, 1.6 Hz, 1H), 7.62 – 7.51 (m, 3H), 7.48 (td, J = 7.7, 1.7 Hz, 1H), 7.45 – 7.39 (m, 1H), 7.32 (td, J = 7.6, 1.2 Hz, 1H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.28 (s, 3F); ¹³C NMR (151 MHz, DMSO-d₆) δ 166.97, 164.62, 139.81, 136.68, 136.22, 131.80, 131.58, 130.01, 129.98, 129.89, 129.40, 129.19, 129.03, 128.94, 127.40, 126.26, 125.05, 124.38, 123.93, 122.76, 120.10, 120.07, 116.50, 116.47; HRMS (ESI) m/z (M+H) calcd. for C₂₁H₁₅ClF₃N₂O₂, 419.0769; found 419.0769.

2-(Trifluoromethoxy)-N-(2-((3-(trifluoromethy1)phenyl)carbamoyl)phenyl)benzamide (39)

The title compound was prepared according to general protocol C. Yield: 91%; LC-MS Retention Time: t₁ (Method 1) = 6.983 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.97 (s, lH), 10.74 (s, lH), 8.09–8.26 (m, 2H), 7.91–8.03 (m, lH), 7.83 (dd,1=7.8, 1.6 Hz, lH), 7.77 (dd,1=7.6, 2.0 Hz, lH), 7.39–7.70 (m, 6H), 7.33 (td, J = 7.6, 1.3 Hz, lH); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −56.63 (s, 3F), −61.33 (s, 3F); ¹³C NMR (101 MHz, DMSO-d₆) δ 166.96, 162.80, 144.79, 139.64, 137.01, 132.53, 131.98, 130.14, 130.00, 129.83, 129.46, 128.90, 127.89, 125.23, 124.15, 124.00, 122.35, 121.83, 120.18, 116.60; HRMS (ESI) m/z (M+H) calcd. for C₂₂H₁₅F₆N₂O₃, 468.0981; found 468.0982.

2-Ethoxy-N(2-((3-(trifluoromethyl)pheny1)carbamoyl)phenyl) benzamide (40)

The title compound was prepared according to general protocol C. Yield: 47%; LC-MS Retention Time: t₁ (Method 1) = 6.998 min; ¹H NMR (400 MHz, DMSO-d₆) δ 11.33 (s, lH), 10.82 (s, lH), 8.51 (dd, J = 8.4, 1.2 Hz, lH), 8.28(t, J = 2.1 Hz, lH), 7.89–8.07 (m, 2H), 7.80 (dd, J = 7.8, 1.6 Hz, lH), 7.55–7.65 (m, 2H), 7.38–7.55 (m, 2H), 7.27 (td, J = 7.6, 1.3 Hz, lH), 7.19 (dd, J = 8.4, 1.0 Hz, lH), 7.01–7.12 (m, lH), 4.30(q, J = 6.9 Hz, 2H), 1.30 (t, J = 6.9 Hz, 3H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.40 (s, 3F); ¹³C NMR (101 MHz, DMSO-d₆) δ 167.66, 163.81, 156.43, 140.11, 138.08, 133.89, 132.28, 131.95, 130.39, 129.98, 129.66, 129.11, 124.75, 124.19, 123.65, 122.64, 122.57, 121.13, 120.74, 120.70, 116.73, 116.69, 113.48, 64.55, 40.60, 40.40, 40.19, 39.98, 39.77, 39.56, 39.35, 14.27; HRMS (ESI) m/z (M+H) calcd. for C₂₃H₂₀F₃N₂O₃, 429.1421; found 429.1425.

2-Isopropoxy-N-(2-((3-(trifluoromethyl)phenyl)carbamoyl)phenyl)-benzamide (41)

The title compound was prepared according to general protocol H. Yield: 9%; LC-MS Retention Time: t₁ (Method 1) = 7.126 min; ¹H NMR (600 MHz, DMSO-d₆) δ 11.18 (s, 1H), 10.87 (s, 1H), 8.50 (dd, J = 8.3, 1.1 Hz, 1H), 8.36 (t, J = 1.9 Hz, 1H), 7.91 (ddd, J = 11.7, 7.5, 1.7 Hz, 2H), 7.82 (dd, J = 7.8, 1.6 Hz, 1H), 7.63 – 7.57 (m, 2H), 7.54 – 7.44 (m, 2H), 7.29 (td, J = 7.6, 1.2 Hz, 1H), 7.22 – 7.17 (m, 1H), 7.05 (ddd, J = 7.9, 7.3, 1.0 Hz, 1H), 4.82 (p, J = 6.1 Hz, 1H), 1.34 (d, J = 6.0 Hz, 6H); ¹³C NMR (151 MHz, DMSO-d₆) δ 170.14, 166.71, 158.40, 142.76, 140.69, 136.44, 134.96, 134.68, 133.00, 132.55, 132.34, 131.84, 127.27, 126.83, 126.37, 125.83, 125.56, 123.54, 123.37, 123.35, 119.39, 119.36, 117.02, 74.24, 24.10; HRMS (ESI) m/z (M+H) calcd. For C₂₄H₂₂F₃N₂O₃, 443.1577; found 443.1599.

2,6-Dimethoxy-N-(2-((3-(trifluoromethyl)phenyl)carbamoyl)phenyl)benzamide (42)

The title compound was prepared according to general protocol C. Yield: 88%; LC-MS Retention Time: t₁ (Method 1) = 6.400 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.68 (s, lH), 10.62 (s, lH), 8.43 (d, J = 8.2 Hz, lH), 8.08 (s, lH), 7.93 (d, J =8.4 Hz, lH), 7.85 (dd, J =7.7, 1.1 Hz, lH), 7.52–7.64 (m, 2H), 7.45 (d, J =7.6 Hz, lH), 7.34 (t, J = 8.4 Hz, lH), 7.27 (td, J = 7.6, 1.1 Hz, lH), 6.71 (d, J = 8.4 Hz, 2H), 3.69 (s, 6H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.29 (s, 3F); ¹HRMS (ESI) m/z (M+H) calcd. for C₂₃H₂₀F₃N₂O₄, 445.1370; found 445.1380.

2-(2-Methoxyethoxy)-N-(2-((3-(trifluoromethyl)phenyl)carbamoyl)phenyl)benzamide (43)

The title compound was prepared according to general protocol H. Yield: 16%; LC-MS Retention Time: t₁ (Method 1) = 6.625 min; ¹H NMR (600 MHz, DMSO-d₆) δ 11.25 (s, 1H), 10.84 (s, 1H), 8.45 (dd, J = 8.4, 1.1 Hz, 1H), 8.23 (d, J = 1.9 Hz, 1H), 7.94 (ddd, J = 22.5, 8.1, 2.1 Hz, 2H), 7.82 (dd, J = 7.8, 1.6 Hz, 1H), 7.65 – 7.57 (m, 2H), 7.53 (ddd, J = 8.8, 7.2, 1.8 Hz, 1H), 7.51 – 7.46 (m, 1H), 7.29 (td, J = 7.5, 1.2 Hz, 1H), 7.25 (dd, J = 8.4, 1.0 Hz, 1H), 7.09 (td, J = 7.6, 1.0 Hz, 1H), 4.37 – 4.31 (m, 2H), 3.69 – 3.63 (m, 2H), 3.12 (s, 3H). ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.36 (s, 3F); ¹³C NMR (151 MHz, DMSO-d₆) δ 167.18, 163.39, 156.25, 139.72, 138.97, 137.58, 133.39, 131.90, 131.37, 129.99, 129.49, 129.28, 128.83, 124.55, 123.85, 123.39, 122.40, 122.35, 121.07, 120.29, 116.39, 113.62, 69.79, 67.95, 58.06; HRMS (ESI) m/z (M+H) calcd. for C₂₄H₂₂F₃N₂O₄, 459.1526; found 459.1527.

2-(2-(Dimethylamino)ethoxy)-N-(2-((trifluoromethyl)phenyl)carbamoyl)-phenyl)benzamide (44)

The title compound was prepared according to general protocol H. Yield: 4%; LC-MS Retention Time: t₁ (Method 1) = 4.705 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 11.11 (s, 1H), 10.84 (s, 1H), 8.41 (dd, J = 8.5, 1.3 Hz, 1H), 8.07–8.20 (m, 1H), 7.96 (dd. J =8.0. 1.2 Hz, 1H), 7.87 (dd, J = 7.7. 1.9 Hz, 1H), 7.84 (dd, J = 7.8, 1.8 Hz, 1H). 7.57–7.65 (m, 2H), 7.52–7.57 (m, 1H), 7.45–7.52 (m, 1H), 7.24–7.33 (m, 2H), 7.13 (td, J = 7.5, 1.0 Hz, 1H), 4.55 (t, J = 5.l Hz, 2H), 3.49–3.74 (m, 2H), 2.78 (s, 6H); HRMS (ESI) m/z (M+H) calcd. for C₂₅H₂₅F₃N₃O₃, 472.1843; found 472.1851.

2-(2-Ethoxybenzamido)-N-(3-((trifluoromethyl)sulfonyl)phenyl)nicotinamide (49)

The title compound was prepared according to general protocol A. Yield: 45%; LC-MS Retention Time: t₁ (Method 1) = 5.472 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.98 (s, lH), 10.81 (s, lH), 8.47–8.66 (m, 2H), 8.05–8.24 (m, 2H), 7.75–7.87 (m, 2H), 7.72 (dd, J = 7.8, 2.0 Hz, lH), 7.51 (ddd, J = 8.5, 7.1, 2.0 Hz, lH), 7.39 (dd, J = 7.6, 4.9Hz, lH), 7.20 (d, J = 8.2Hz, lH), 7.00 (t, J = 7.4 Hz, lH), 4.27 (q, J = 7.0 Hz, 2H), 1.42 (t, J =7.0 Hz, 3H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −78.44 (s, 3F); ¹³C NMR (151 MHz, DMSO-d₆) δ 165.91, 163.44, 156.44, 150.26, 148.04, 141.24, 137.87, 133.55, 131.38, 130.94, 129.86, 128.00, 125.15, 124.02, 121.63, 120.76, 120.51, 120.43, 120.27, 118.35, 113.33, 64.71, 14.44; HRMS (ESI) m/z (M+H) calcd. for C₂₂H₁₉F₃N₃O₅S, 494.0992; found 494.1004.

3-(2-Ethoxybenzamido)-N-(3-((trifluoromethyl)sulfonyl)phenyl)isonicotinamide (50)

The title compound was prepared according to general protocol A. Yield: 38%; LC-MS Retention Time: t₁ (Method 1) = 5.766 min; HRMS (ESI) m/z (M+H) calcd. for C₂₂H₁₉F₃N₃O₅S, 494.0992; found 494.1000.

4-(2-Ethoxybenzamido)-N-(3-((trifluoromethyl)sulfonyl)phenyl)nicotinamide (51)

The title compound was prepared according to general protocol A. Yield: 26%; LC-MS Retention Time: t₁ (Method 1) = 5.507 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 11.71 (s, lH), 11.25 (s, lH), 9.00 (s, lH), 8.77 (t, J = 2.2 Hz, lH), 8.65–8.71 (m, lH), 8.54–8.64 (m, lH), 8.15–8.26 (m, lH), 7.96 (dd, .J = 7.8, 2.3 Hz, lH), 7.78–7.93 (m, 2H), 7.56 (ddd, J =8.6, 7.0, 2.0 Hz, lH), 7.24 (d, J = 8.6 Hz, lH), 7.09 (t, J =7.4 Hz, lH), 4.35 (q, J = 6.9 Hz, 2H), 1.29 (t, J = 6.8 Hz, 3H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −78.37 (s, 3F); ¹³C NMR (151 MHz, DMSO-d₆) δ 169.07, 167.39, 159.21, 156.20, 153.04, 147.91, 143.56, 137.33, 134.89, 134.57, 133.02, 131.82, 129.06, 124.40, 124.05, 123.94, 123.60, 121.44, 120.83, 117.83, 116.25, 67.26, 16.85; HRMS (ESI) m/z (M+H) calcd. for C₂₂H₁₉F₃N₃O₅S, 494.0992; found 494.1004.

2-(2-Ethoxybenzamido)-N-(3-((trifluoromethyl)sulfonyl)phenyl)-nicotinamide (52)

The title compound was prepared according to general protocol A. yield: 51%; LC-MS Retention Time: t₁ (Method 1) = 7.402 min; HRMS (ESI) m/z (M+Na)⁺ calcd. for C₂₂H₁₈F₃N₃NaO₅S, 516.0811; found 516.0837.

2-(2-Ethoxyphenylsulfonamido)-N-(3-((trifluoromcthy1)sulfonyl)phenyl)-benzamide (53)

The title compound was prepared according to general protocol A. Yield: 29%; LC-MS Retention Time: t₁ (Method 1) = 6.631 min; ¹H NMR (400 MHz, DMSO-d₆) δ 11.00 (s, 1H), 10.37 (s, 1H), 8.64 (t, J = 1.9 Hz, 1H), 8.24 (dt, J = 7.8, 1.8 Hz, 1H), 7.96 – 7.84 (m, 2H), 7.82 (dd, J = 7.8, 1.7 Hz, 2H), 7.60 – 7.50 (m, 2H), 7.48 (ddd, J = 8.5, 7.3, 1.5 Hz, 1H), 7.18 (td, J = 7.6, 1.2 Hz, 1H), 7.12 – 7.00 (m, 2H), 3.95 (q, J = 7.0 Hz, 2H), , 1.18 (t, J = 7.0, 3H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ −78.37; ¹³C NMR (101 MHz, DMSO-d₆) δ 167.47, 155.62, 140.29, 137.78, 135.61, 133.03, 131.39, 130.49, 129.95, 129.46, 128.91, 125.92, 125.37, 123.06, 121.39, 121.31, 121.05, 120.03, 118.75, 117.80, 113.56, 64.53, 13.68; HRMS (ESI) m/z (M+H) calcd. for C₂₂H₂₀F₃N₂O₆S₂, 529.0709; found 529.0716.

2-Methoxy-N-methy1-N-(2-((3-(trifluoromethyl)pheny1)carbamoy1)phenyl)benzamide (54)

The title compound was prepared according to general protocol A. Yield: 47%; LC-MS Retention Time: t₁ (Method 1) = 6.046 min; HRMS (ESI) m/z (M+H) calcd. for C₂₃H₂₀F₃N₂O₃, 429.1421; found 429.1438.

2-(2-Methoxybenzamido)-N-methyl-N-(3-(trifluoromethyl)phenyl) benzamide (55)

The title compound was prepared according to general protocol A. Yield: 60%; LC-MS Retention Time: t₁ (Method 1) = 6.442 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.65 (d, J = 0.8 Hz, lH), 8.21 (dt, J = 8.4, 0.6 Hz, lH), 8.03 (dd, J = 7.8, 1.8 Hz, lH), 7.54–7.66 (m, 2H), 7.37–7.54 (m, 3H), 7.20–7.33 (m, 2H), 7.13 (ddd, J = 7.9, 7.2, 1.0 Hz, lH), 7.04–7.11 (m, lH), 6.86–6.96 (m, lH), 4.02 (s, 3H), 3.44 (s, 3H); HRMS (ESI) m/z (M+H) calcd. for C₂₃H₂₀F₃N₂O₃, 429.1241; found 429.1418.

2-((2-Methoxyethyl)amino)-N-(3-(trifiuoromethyl)phenyl)-benzamide (57)

The title compound was prepared according to general protocol F. Yield: 19%; LC-MS Retention Time: t₁ (Method 1) = 6.254 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.33 (s, lH), 8.14 (t, J = 2.2 Hz, lH), 7.88–8.05 (m, lH), 7.70 (dd, J = 7.8, 1.6 Hz, lH), 7.54–7.63 (m, lH), 7.44–7.52 (m, lH), 7.37–7.44 (m, lH), 7.34 (ddd, J = 8.6, 7.0, 1.7 Hz, lH), 6.72–6.84 (m, lH), 6.65 (ddd, J = 8.0, 7.1, 1.2 Hz, lH), 3.53 (t, J = 5.5 Hz, 2H), 3.28 (s, 3H), 3.24–3.33 (m, 2H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.23 (s, 3F); ¹³C NMR (101 MHz, DMSO-d₆) δ 168.36, 149.33, 139.94, 133.15, 129.75, 129.19, 129.08, 124.02, 119.73, 116.55, 116.51, 114.97, 114.37, 111.30, 70.34, 58.03, 41.90; HRMS (ESI) m/z (M+H) calcd. for C₁₇H₁₈F₃NO₂, 339.1315; found 339.1326.

2-(2-Ethoxybenzamido)-N-(3-((trifluoromethyl)sulfonyl)phenyl)thiophene-3-carboxamide (59)

The title compound was prepared according to general protocol A. Yield: 33%; LC-MS Retention Time: t₁ (Method 1) = 7.341 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 13.25 (s, 1H), 10.45 (s, 1H), 8.90 (d, J = 2.2 Hz, 1H), 8.30 – 8.20 (m, 1H), 8.08 (dd, J = 7.9, 1.9 Hz, 1H), 7.90– 7.80 (m, 2H), 7.75 (d, J = 6.0 Hz, 1H), 7.60 (ddd, J = 8.9, 7.3, 1.9 Hz, 1H), 7.31 (dd, J = 8.6, 0.9 Hz, 1H), 7.18–7.08 (m, 2H), 4.51 (q, J = 7.0 Hz, 2H), 1.47 (t, J = 7.0 Hz, 3H). ¹³C NMR (101 MHz, DMSO-d₆) δ 164.07, 162.19, 156.99, 147.77, 141.20, 134.92, 132.43, 131.69, 130.33, 129.06, 125.79, 123.30, 121.47, 121.39, 119.79, 117.58, 115.83, 113.79, 64.98, 14.46; ¹⁹F NMR (376 MHz, DMSO-d₆) δ −78.43 (s, 3F); HRMS (ESI) m/z (M+H) calcd. for C₂₁H₁₈F₃N₂O₅S₂, 499.0604; found 499.0608.

2-Methoxy-N-(3-((3-(trifluoromethyl)phenyl)carbamoyl)phenyl)benzamide (61)

The title compound was prepared according to general protocol A. Yield: 68%; LC-MS Retention Time: t₁ (Method 1) = 6.471 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 10.58 (s, lH), 10.30 (s, lH), 8.27–8.35 (m, lH), 8.23 (t, J = 2.l Hz, lH), 8.04 (dt, J =8.2, 1.1 Hz, lH), 7.88–7.99 (m, lH), 7.67 (ddd, J = 8.0, 1.4, 1.2 Hz, lH), 7.63 (dd, J = 7.6, 1.8 Hz, lH), 7.56–7.62 (m, lH), 7.47–7.56 (m, 2H), 7.41–7.47 (m, lH), 7.14–7.23 (m, lH), 7.06 (td, J = 7.4, l.0 Hz, lH), 3.90 (s, 3H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −61.28 (s, 3F); ¹³C NMR (101 MHz, DMSO-d₆) δ 166.43, 165.23, 156.95, 140.40, 139.69, 135.69, 132.59, 130.32, 130.08, 129.95, 129.24, 125.95, 125.21, 124.18, 123.45, 122.99, 120.93, 119.66, 116.76, 116.72, 112.46; HRMS (ESI) m/z (M+H) calcd. for C₂₂H₁₈F₃N₂O₃, 415.1264; found 415.1275.

2-Methoxy-N-(2-((3-((trifluoromethyl)sulfonyl)phenyl)carbamoy1)phenyl)benzamide (62)

The title compound was prepared according to general protocol G. Yield: 25%; LC-MS Retention Time: t₁ (Method 1) = 6.810 min; ¹H NMR (400 MHz, DMSO-d₆) δ ppm 11.58 (s, 1H), 11.09 (s, 1H), 8.82 (t, J = 2.l Hz, 1H), 8.58 (dd,1=8.5, 1.3 Hz, lH), 8.23 (dt, J = 7.0, 2.2 Hz, lH), 8.02 (dd, J = 7.7, 1.9 Hz, lH), 7.76–7.99 (m, 3H), 7.51–7.63 (m, 2H), 7.27 (td, J = 7.5, 1.2 Hz, 1H), 7.22 (dd, J = 8.4, 1.2 Hz, 1H), 7.09 (ddd, J = 7.2, 1.2 Hz, lH), 3.99 (s, 3H); ¹⁹F NMR (376 MHz, DMSO-d₆) δ ppm −78.39 (s, 3F); ¹³C NMR (101 MHz, DMSO-d₆) δ 167.57, 163.01, 157.16, 140.75, 137.78, 133.69, 132.05, 131.51, 131.37, 129.94, 128.69, 128.43, 125.58, 123.90, 123.10, 122.05, 121.24, 120.84, 120.77, 112.26, 55.59; HRMS (ESI) m/z (M+H) calcd. for C₂₂H₁₈F₃N₂O₅S, 479.0883; found 479.0886.

2-Ethoxy-N-(2-((3-((trifluoromethyl)sulfonyl)phenyl)carbamoyl)phenyl)benzamide (63)

The title compound was prepared according to general protocol A. Yield: 53%; LC-MS Retention Time: t₁ (Method 1) = 6.963 min; ¹H NMR (400 MHz, DMSO-d₆): δ 11.35 (s, 1H), 11.10 (s, 1H), 8.76 (t, J = 2.2 Hz, 1H), 8.53 (d, J = 8.2 Hz, 1H), 8.23 (dt, J = 7.1, 2.3 Hz, 1H), 7.96 (dd, J = 7.8, 2.0 Hz, 1H), 7.80–7.92 (m, 3H), 7.57 – 7.65 (m, 1H), 7.53 (ddd, J = 8.6, 7.0, 2.0 Hz, 1H), 7.30 (td, J = 7.6, 1.2 Hz, 1H), 7.22 (d, J = 8.2 Hz, 1H), 7.04–7.10 (m, 1H), 4.31 (q, J = 6.8 Hz, 2H), 1.31 (t, J = 6.8 Hz, 3H); ¹³C NMR (101 MHz, DMSO-d₆): δ 167.44, 163.39, 156.00, 140.75, 137.73, 133.44, 132.10, 131.48, 131.34, 129.93, 128.81, 128.49, 125.58, 123.86, 123.21, 122.27, 122.08, 120.81, 120.67, 119.41 (q, J = 328 Hz), 113.00, 64.09, 13.80; ¹⁹F NMR (376 MHz, DMSO-d₆): δ −78.40 (s, 3F); HRMS (m/z): [M+H] calcd. for C₂₃H₂₀F₃N₂O₅S, 493.1040; found 493.1044.

2-Isopropoxy-N-(2-(3-(trifluoromethylsulfonyl)phenylcarbamoyl)phenyl)benzamide (64)

The title compound was prepared according to general protocol A. Yield: 44%; LC-MS Retention Time: t₁ (Method 1) = 6.804 min; ¹H NMR (400 MHz, DMSO-d₆): δ 11.10 (s, 1H), 11.05 (s, 1H), 8.64 (s, 1H), 8.44 (d, J = 8.2 Hz, 1H), 8.27 (dt, J = 7.1, 2.3 Hz, 1H), 7.79–7.92 (m, 4H), 7.60–7.69 (m, 1H), 7.52–7.60 (m, 1H), 7.37 (d, J = 8.2 Hz, 1H), 7.31 (t, J = 7.6 Hz, 1H), 7.19 (t, J = 7.4 Hz, 1H), 4.94 (q, J = 9.0 Hz, 2H); ¹³C NMR (101 MHz, DMSO-d₆): δ 167.46, 163.36, 154.24, 140.76, 137.68, 132.87, 132.27, 131.25, 130.85, 129.87, 128.99, 128.60, 125.45, 124.28, 123.83, 123.63 (q, J = 280 Hz), 123.49, 122.52, 121.97, 121.05, 119.42 (q, J = 329 Hz), 114.03, 65.00 (q, J = 35.0 Hz); ¹⁹F NMR (376 MHz, DMSOd₆): δ 72.46 (t, J = 9.4 Hz, 3F), −78.48 (s, 3F); HRMS (m/z): [M+H] calcd. for C₂₃H₁₇F₆N₂O₅S, 547.0757; found 547.0762.

2-Isopropoxy-N-(2-(3-(trifluoromethylsulfonyl)phenylcarbamoyl)phenyl)benzamide (65)

The title compound was prepared according to general protocol A. Yield: 57%; LC-MS Retention Time: t₁ (Method 1) = 6.974 min; t₂ (Method 2) = 3.881 min; ¹H NMR (400 MHz, DMSO-d₆): δ 11.11 (s, 1H), 11.09 (s, 1H), 8.75 (s, 1H), 8.48 (d, J = 8.2 Hz, 1H), 8.20 (dt, J = 7.4, 2.2 Hz, 1H), 7.91 (dd, J = 7.8, 1.6 Hz, 1H), 7.77–7.89 (m, 3H), 7.57–7.66 (m, 1H), 7.51 (ddd, J = 8.6, 7.0, 2.0 Hz, 1H), 7.30 (td, J = 7.5, 1.0 Hz, 1H), 7.20 (d, J = 8.6 Hz, 1H), 7.05 (t, J = 7.4 Hz, 1H), 4.75 – 4.85 (m, 1H), 1.32 (d, J = 5.9 Hz, 6H); ¹³C NMR (101 MHz, DMSO-d₆): δ 167.24, 163.63, 155.29, 140.75, 137.61, 133.30, 132.06, 131.52, 131.28, 129.97 (br.), 128.89, 128.51, 125.58, 123.93, 123.29, 122.79, 122.56, 120.82, 120.44, 119.40 (q, J = 328 Hz), 113.98, 71.19, 21.05; ¹⁹F NMR (376 MHz, DMSO-d₆): δ −78.38 (s, 3F); HRMS (m/z): [M+H] calcd. for C₂₄H₂₂F₃N₂O₅S, 507.1196; found 507.1221.

2-Propoxy-N-(2-((3-((trifluoromethyl)sulfonyl)phenyl)carbamoyl)phenyl)benzamide (66)

The title compound was prepared according to general protocol A. Yield: 41%; LC-MS Retention Time: t₁ (Method 1) = 7.147 min; ¹H NMR (400 MHz, DMSO-d₆): δ 11.26 (s, 1H), 11.10 (s, 1H), 8.72 (s, 1H), 8.54 (d, J = 8.6 Hz, 1H), 8.24 (dt, J = 7.1, 2.3 Hz, 1H), 7.94 (dd, J = 7.8, 2.0 Hz, 1H), 7.78 – 7.91 (m, 3H), 7.56 – 7.67 (m, 1H), 7.52 (ddd, J = 8.5, 7.1, 2.0 Hz, 1H), 7.25–7.33 (m, 1H), 7.20 (d, J = 8.2 Hz, 1H), 7.07 (t, J = 7.4 Hz, 1H), 4.16 (t, J = 7.0 Hz, 2H), 1.71 (sxt, J = 7.2 Hz, 2H), 0.77 (t, J = 7.4 Hz, 3H); ¹³C NMR (101 MHz, DMSO-d₆): δ 167.42, 163.49, 156.14, 140.78, 137.75, 133.37, 132.14, 131.39, 131.33, 129.95 (br.), 128.90, 128.48, 125.54, 123.80, 123.21, 122.25, 122.15, 120.88, 120.68, 119.43 (q, J = 328 Hz), 113.09, 69.82, 21.24, 9.74; ¹⁹F NMR (376 MHz, DMSO-d₆): δ −78.43 (s, 3F); HRMS (m/z): [M+H] calcd. for C₂₄H₂₂F₃N₂O₅S, 507.1196; found 507.1219.

2-Butoxy-N-(2-((3-((trifluoromethyl)sulfonyl)phenyl)carbamoyl)phenyl)benzamide (67)

The title compound was prepared according to general protocol A. Yield: 49%; LC-MS Retention Time: t₁ (Method 1) = 7.325 min; t₂ (Method 2) = 3.971 min; ¹H NMR (400 MHz, DMSO-d₆): δ 11.27 (s, 1H), 11.10 (s, 1H), 8.71 (s, 1H), 8.55 (d, J = 8.2 Hz, 1H), 8.26 (dt, J = 7.3, 2.0 Hz, 1H), 7.93 (dd, J = 7.8, 2.0 Hz, 1H), 7.81–7.91 (m, 3H), 7.58–7.68 (m, 1H), 7.47–7.57 (m, 1H), 7.29 (t, J = 7.4 Hz, 1H), 7.22 (d, J = 8.2 Hz, 1H), 7.08 (t, J = 7.4 Hz, 1H), 4.19 (t, J = 6.8 Hz, 2H), 1.57–1.73 (m, 2H), 1.23 (sxt, J = 7.5 Hz, 2H), 0.70 (t, J = 7.4 Hz, 3H); ¹³C NMR (101 MHz, DMSO-d₆): δ 167.41, 163.52, 156.13, 140.81, 137.81, 133.37, 132.20, 131.36, 131.34, 129.96 (br.), 128.94, 128.41, 125.54, 123.59, 123.18, 122.30, 122.06, 120.85, 120.69, 113.09, 68.19, 29.93, 18.34, 13.37; ¹⁹F NMR (376 MHz, DMSO-d₆): δ −78.42 (s, 3F); HRMS (m/z): [M+H] calcd. for C₂₅H₂₄F₃N₂O₅S, 521.1353; found 521.1359.

Highlights.

• A high throughput screening campaign identified the first small molecule relaxin peptide hormone receptor agonists

• An extensive medicinal chemistry effort produced an optimized, potent lead compound

• Pharmokinetic studies show good compound bioavailability in mice with no observed toxicity

• The lead compound displays an antifibrotic gene expression profile in activated human hepatic stellate cells

ABBREVIATIONS USED

AcOH

acetic acid

aq

aqueous

CH₂Cl₂

dichloromethane

conc

concentrated

DIPEA

diisopropylethylamine

DMAP

dimethylaminopyridine

DME

1,2-dimethoxyethane

DMF

N,Ndimethylformamide

DMSO

dimethyl sulfoxide

EDC

1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide

Et₂O

diethyl ether

EtOAc

ethyl acetate

EtOH

ethanol

H₂O

water

HATU

1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate

HCl

hydrochloric acid

iPr₂NH

diisopropylamine

IV

intervenous

K₂CO₃

potassium carbonate

KOAc

potassium acetate

LCMS

liquid chromatography/mass spectrometry

M

molar

mM

millimolar

MeOH

methanol

MHz

megahertz

N₂

nitrogen

NaHCO₃

sodium bicarbonate

Na₂CO₃

sodium carbonate

NaOH

sodium hydroxide

NH₄Cl

ammonium chloride

PBS

phosphate-buffered saline

Pd(dppf)Cl₂·CH₂Cl₂

[1,1]-bis(diphenylphosphino)ferrocene]dichloropalladium (II) complex with dichloromethane

Pd(PPh₃)₄

tetrakis(triphenylphosphine)palladium (0)

PO

by mouth

RXFP

relaxin/insulin-like family peptide receptor

TFA

trifluoroacetic acid

THF

tetrahydrofuran

TGF

tumor growth factor

TNF

tumor necrosis factor

μW

microwave irradiation.