Table 2.
Primer and probes
| Gene title | Accession number# | Primer sequence | UPL | |
|---|---|---|---|---|
| forward | reverse | probe | ||
| ACAN |
NM_001135.3 NM_013227.3 |
ctggaagtcgtggtgaaagg | tcgagggtgtagcgtgtaga | 21 |
| COL1A1 | NM_000088.3 | gggattccctggacctaaag | ggaacacctcgctctcca | 67 |
| COL2A1 |
NM_001844.4 NM_033150.2 |
ccctggtcttggtggaaa | cattggtccttgcattactcc | 19 |
| FOXF1 | NM_001451.2 | cagcctctccacgcactc | cctttcggtcacacatgct | 5 |
| KRT18 |
NM_000224.2 NM_199187.1 |
aagctggaggctgagatcg | tccaaggcatcaccaagatta | 70 |
| ATP5FB1* | NM_001686.3 | agaggtcccatcaaaaccaa | tcctgctcaacactcatttcc | 50 |
| RPL13A* |
NM_012423.3 NM_00127049.1 |
caagcggatgaacaccaac | tgtggggcagcatacctc | 28 |
*Housekeeping genes used as reference genes in normalisation for calculation of mRNA expression level
#Includes all transcript variants of this gene covered by the chosen primers