Antibodies |
|
Pierce High Sensitivity Streptavidin-HRP antibody |
ThermoFisher Scientific |
Cat#21130 |
Rabbit polyclonal e-IF2α-P antibody |
ThermoFisher Scientific |
Cat#44-728G; RRID: AB_2533736
|
Mouse monoclonal e-IF2α antibody |
Abcam |
Cat#ab5369; RRID: AB_304838
|
Mouse monoclonal tubulin antibody |
Sigma-Aldrich |
Cat#T5168; RRID: AB_477579
|
Mouse monoclonal BiP antibody |
BD Biosciences PharMingen |
Cat#610978; RRID: AB_398291
|
Rabbit polyclonal ATF4 antibody |
Santa Cruz Biotechnology |
Cat#sc-200; RRID: AB_2058752
|
Rabbit polyclonal Ppp1r15a antibody |
Proteintech |
Cat#10449-1-AP; RRID: AB_2168724
|
Rabbit polyclonal Ppp1r15b antibody |
Proteintech |
Cat# 14634-1-AP; RRID: AB_2300036
|
Mouse monoclonal CHOP antibody |
ABR Affinity BioReagents |
Cat#MA1-250; RRID: AB_2292611
|
Mouse monoclonal huntingtin antibody 2B4 antibody |
Euromedex |
Cat#HU-2B4 |
Mouse monoclonal huntingtin antibody 1C2 antibody |
Euromedex |
Cat#PQ-1C2 |
Goat polyclonal Alexa Fluor 488 antibody |
ThermoFisher Scientific |
Cat#A11001; RRID: AB_2534069
|
Mouse monoclonal MBP-HRP antibody |
New England BioLabs |
Cat#E8038; RRID: AB_1559738
|
Rabbit polyclonal e-IF2α antibody |
Abcam |
Cat#ab26197; RRID: AB_2096478
|
Rabbit polyclonal e-IF2α-P (Ser51) antibody |
Cell Signaling Technology |
Cat#9721; RRID: AB_330951
|
|
Bacterial and Virus Strains |
|
E. coli BL21-GOLD (DE3) pLysS |
Agilent Technologies |
Cat#230134 |
E. coli BL21/pGro7 |
Takara |
Cat#9122 |
|
Chemicals, Peptides, and Recombinant Proteins |
|
MBP-R15A325-636-His (R15A) |
Das et al., 2015 |
N/A |
MBP-R15B340-698-His (R15B) |
Das et al., 2015 |
N/A |
bio-PP1c1-322 (bio-PP1c) |
This study |
N/A |
his-PP1c1-322 (his-PP1c) |
This study |
N/A |
MBP-R15A325-512R15B636-698-His (R15AN-R15BC) |
Carrara et al., 2017 |
N/A |
MBP-R15B340-635R15A513-636-His (R15BN-R15AC) |
Carrara et al., 2017 |
N/A |
PP1c7-330 (PP1c) |
Carrara et al., 2017 |
N/A |
GST-PERK |
Carrara et al., 2017 |
N/A |
eIF2a1-185-His |
Carrara et al., 2017 |
N/A |
bio-GBZ |
Tsaytler et al., 2011 |
N/A |
Guanabenz (GBZ) |
Sigma-Aldrich |
Cat#G110 |
Sephin1 |
Das et al., 2015 |
N/A |
Raphin1 |
This study |
N/A |
Compound C3 |
This study |
N/A |
MG-132 |
Cell Signaling technology |
Cat#2194 |
NSM-873 |
Selleckchem |
Cat# S7285 |
CB-5083 |
Cayman Chemicals |
Cat#2194 |
CalyculinA |
Cell signaling technology |
Cat#9902S |
CellTox Green Dye, 1,000X |
Promega |
Cat#G873B |
Cycloheximide |
Sigma-Aldrich |
Cat#C7698 |
Hematoxylin |
VWR International |
Cat#351945S |
Oil Red O solution |
VWR International |
Cat#101410-976 |
RNeasy Mini Kit |
QIAGEN |
Cat#74104 |
iScript cDNA Synthesis Kit |
Bio-Rad |
Cat#1708891 |
SYBR Select Master Mix |
Applied Biosystems |
Cat#44-729-08 |
O.C.T. compound |
VWR International |
Cat#361603E |
Hoechst 33342 |
Lonza |
Cat#PA-3014 |
|
Critical Commercial Assays |
|
Bac-to-Bac Baculovirus Expression System |
ThermoFisher Scientific |
Cat#10359-016 |
EnzChek Phosphatase Assay Kit |
ThermoFisher Scientific |
Cat#E12020
|
Accu-Chek Aviva Blood Glucose Meter |
Roche |
Cat#06351557018 |
Accu-Chek Aviva Glucose Test Strips |
Roche |
Cat#06453970 |
|
Experimental Models: Cell Lines |
|
HeLa (Female) |
Sigma-Aldrich |
IGBMC, Illkirch, France |
MEF cells: Ppp1r15a −/− (R15a −/−). Sex undetermined. |
Harding et al., 2009 |
N/A |
MEF cells: Ppp1r15b −/− (R15b −/−) Sex undetermined. |
Harding et al., 2009 |
N/A |
S. frugiperda Sf9 SFM adapted insect cells. Sex undetermined. |
ThermoFisher Scientific |
Cat#11496015 |
|
Experimental Models: Organisms/Strains |
|
C57BL/6J |
The Jackson Laboratory |
Cat#000664 |
B6C3-Tg(HD82Gln)81Gschi/J (N171-82Q) |
The Jackson Laboratory |
Cat#003627 |
CMT-1B |
Lawrence Wrabetz |
N/A |
B6.129P2-Ppp1r15atm1.1Ajf/Mmnc (R15a −/−) |
MMRRC (mutant mouse resource and research centers) |
Cat#30266 |
|
Oligonucleotides |
|
R15a – f: GACCCCTCCAACTCTCCTTC |
Sigma-Aldrich |
N/A |
R15a – r: TCTCAGGTCCTCCTTCCTCA |
Sigma-Aldrich |
N/A |
Chop – f: GGAGAGAGTGTTCAAGAAGGAAGTG |
Sigma-Aldrich |
N/A |
Chop – r: GCAGGTCCTCATACCAGGCTT |
Sigma-Aldrich |
N/A |
Gapdh – f: TGGGTGGTCCAGGGTTTCTTACTCCTT |
Sigma-Aldrich |
N/A |
Gapdh – r: CGACTTCAACAGCAACTCCCACTCTTCC |
Sigma-Aldrich |
N/A |
|
Recombinant DNA |
|
pMAL-c5x |
New England BioLabs |
Cat#8108S |
Bac-to-Bac vector kit (pFastBac1) |
ThermoFisher Scientific |
Cat#10360014 |
pDW464 |
Addgene |
Cat#8845 |
Plasmid pMAL-c5x-R15A325-636 (N-terminal MBP-tag, C-terminal 6 × His-tag) |
Das et al., 2015 |
N/A |
Plasmid pMAL-c5x-R15B340-698 (N-terminal MBP-tag, C-terminal 6 × His-tag) |
Das et al., 2015 |
N/A |
Plasmid pDW464-PP1γc1-322 (N-terminal BAP-tag) |
This study |
N/A |
Plasmid pFastBac1-6 × His-PP1γc1-322 (N-terminal 6 × His-tag) |
This study |
N/A |
Plasmid pMAL-c5x-R15A325-512R15B636-698 (N-terminal MBP-tag, C-terminal 6 × His-tag) |
Carrara et al., 2017 |
N/A |
Plasmid pMAL-c5x-R15B340-635R15A513-636 (N-terminal MBP-tag, C-terminal 6 × His-tag) |
Carrara et al., 2017 |
N/A |
Plasmid modified pGEX6p1-PP1αc7-330 (the vector's GST-tag was replaced by an N-terminal Thio6/His6-tag (MGSDKIHHHHHH)). |
Carrara et al., 2017 |
N/A |
Plasmid pGEX-4T-1-PERK537-1114 (N-terminal GST-tagged murine PERK kinase domain) |
Addgene |
Cat#21817 |
Solubility enhanced human eIF2a (amino acids 1-185) with a C-terminal His-tag |
Ito et al., 2004 |
N/A |
|
Software and Algorithms |
|
Biacore T200 Evaluation Software |
GE Healthcare |
https://www.biacore.com/lifesciences/service/downloads/software_licenses/biaevaluation/ |
GraphPad Prism 7 |
GraphPad Software |
https://www.graphpad.com/scientific-software/prism/ |
ImageJ |
NIH |
https://imagej.nih.gov/ij/ |
IncuCyte Zoom software |
Essen BioScience |
https://www.essenbioscience.com/en/ |
ViewPoint |
ViewPoint Behavior Technology, France |
http://www.viewpoint.fr/en/home |
Coulbourn Instruments |
Coulbourn Instruments, Allentown, PA, USA |
https://www.coulbourn.com/ |
Graphic State software |
Coulbourn Instruments, Allentown, PA, USA |
https://www.coulbourn.com/ |
NIS Elements |
Nikon Instruments |
https://www.nikoninstruments.com/en_EU/Products/Software |