Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Short hairpin RNA target sequences.
| Sequence name | Symbol | Location | Length | Target sequence |
|---|---|---|---|---|
| Sequence 1 | Pcsk9 | 891 | 21 | ggaacctggagcgaattatcc |
| Sequence 2 | Pcsk9 | 964 | 21 | ggaggtgtatctcttagatac |
| Sequence 3 | Pcsk9 | 1,228 | 21 | ggagtttattcggaagagtca |
| Sequence 4 | Pcsk9 | 109 | 21 | ccgaaacctgatcctttagta |
