Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for microbial community composition analysis.
| Microbes | Primer sequence (5′ to 3′) | Size, bp | Literature cited |
|---|---|---|---|
| Bacteria-F | GGCGVACGGGTGAGTAA | 427 | Hristov et al. (2012) |
| Bacteria-R | CCGCNGCNGCTGGCAC | ||
| Methanogen-F | AGGAATTGGCGGGGGAGCAC | 472 | Jeyanathan et al. (2011) |
| Methanogen-R | GCGGTGTGTGCAAGGAGC | ||
| Protozoa-F | AATTGCAAAGATCTATCCC | 511 | Kittelmann et al. (2013) |
| Protozoa-R | GACTAGGGATTGGAGTGG |
F = forward; R = reversed.
