| Antibodies |
| PE/Cy7 anti-mouse CD3 |
eBioscience |
25-0031-82; RRID: AB_469572 |
| APC anti-mouse CD4 |
BD Bioscience |
553051 |
| PE anti-mouse CD4 |
eBioscience |
12-0042-83; RRID: AB_465510 |
| PerCP/Cy5.5 anti-mouse CD8 |
Biolegend |
100734; RRID: AB_2075238 |
| PE/Cy7 anti-mouse CD11b |
Biolegend |
101216; RRID: AB_312799 |
| Pacific Blue anti-mouse/human
CD44 |
Biolegend |
103020; RRID: AB_493683 |
| APC anti-mouse CD11c |
Biolegend |
117310; RRID: AB_313779 |
| FITC anti-mouse CD86 |
BD Bioscience |
553691 |
| eFluor 450 anti-mouse F4/80 |
eBioscience |
48-4801-82; RRID: AB_1548747 |
| Alexa Fluor 488 anti-mouse FoxP3 |
Biolegend |
126406; RRID: AB_1089113 |
| PE anti-mouse Granzyme-B |
eBioscience |
12-8898-82; RRID: AB_10870787 |
| Brilliant Violet 510 anti-mouse
CD45 |
eBioscience |
103137; RRID: AB_2561392 |
| Alexa Fluor 700 anti-mouse CD25 |
eBioscience |
56-0251-82; RRID: AB_891422 |
| eFluor 780 Fixable Viability Dye |
eBioscience |
65-0865-14 |
| Alexa Fluor 700 anti-mouse GR-1
Ly6 |
Biolegend |
108422; RRID: AB_2137487 |
| PerCP/Cy5.5 anti-mouse NK1.1 |
Biolegend |
108728; RRID: AB_2132705 |
| PerCP/Cy5.5 anti-mouse DX-5 |
Biolegend |
108916; RRID: AB_2129358 |
| PE anti-mouse MHC-II |
eBioscience |
12-5321-81; RRID: AB_465928 |
| Alexa Fluor 488 anti-mouse IgG |
Thermo Fisher Scientific |
A-11001; RRID: |
| Anti-rabbit IgG Cross-adsorbed |
Thermo Fisher Scientific |
AB_253406931213; RRID: AB_228376 |
| Pacific Blue Rat IgG2b κ
isotype control |
Biolegend |
400627 |
| Alexa Fluor 488 Rat IgG2b κ
isotype control |
Biolegend |
400625 |
| PE Rat IgG2b κ isotype
control |
Thermo-Fisher Scientific |
12-4031-82; RRID: AB_470042 |
| FITC Rat IgG2a κ isotype
control |
BD Biosciences |
553929 |
| PE Rat IgG2a κ isotype
control |
eBioscience |
12-4321-80; RRID: AB_1834380 |
| Alexa Fluor 700 Rat IgG1 κ
isotype control |
eBioscience |
56-4301-80; RRID: AB_494017 |
| Anti SSEA-1 microbeads |
Miltenyi Biotec |
130-094-530 |
| Oct 3/4 anti-mouse |
Santa Cruz Biotechnology |
sc-5279 |
| c-Myc anti-mouse |
EMD Millipore |
06-340 |
| SSEA-1 anti-mouse |
EMD Millipore |
MAB4301 |
| Nanog anti-mouse |
Santa Cruz Biotechnology |
sc-33760 |
| Sox2 anti-mouse |
Santa Cruz Biotechnology |
sc-365823 |
| Mouse on Mouse (M.O.M.) Basic Kit |
Vector Laboratories |
BMK-2202 |
| Fc Block anti-mouse |
BD Biosciences |
553141 |
|
|
|
|
|
|
|
|
|
| Bacterial and Virus
Strains |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| Biological Samples |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| Chemicals, Peptides, and
Recombinant Proteins |
| DMEM, high glucose, GlutaMAX |
Gibco |
10569-010 |
| Fetal Bovine Serum |
Life Technologies |
26140079 |
| DPBS, no calcium, no magnesium |
Gibco |
14190250 |
| MEM Non-Essential Amino Acids |
Gibco |
11140050 |
| TrypLE Express |
Gibco |
12605-036 |
| CpG ODN 1826 |
Invivogen |
tlrl-1826-1 |
| Murine Leukemia Inhibitory Factor
(mLIF) |
EMD Millipore |
ESG1106 |
| Gelatin |
Sigma Aldrich |
G1393-100ML |
| Isothesia |
Henry Schein |
029405 |
| Matrigel™ matrix growth factor
reduced |
BD Biosciences |
356231 |
| RPMI medium 1640 |
Life Technologies |
11875-119 |
| ACK lysis buffer |
Quality Biological |
118-156-101 |
| Collagenase D |
Roche |
11088882001 |
| Deoxyribonuclease I from bovine
pancreas |
Sigma Aldrich |
D4263-5VL |
| Trypsin Inhibitor |
Sigma Aldrich |
T9003-1G |
| HEPES 1M |
Sigma Aldrich |
H3662 |
| Percoll GE Density Gradient Media |
VWR |
89428-524 |
| UltraPure 0.5M EDTA |
Life Technologies |
15575-020 |
| PrimeStar GXL DNA Polymerase |
Clontech |
R050A |
| ddPCR Supermix for Probes |
Bio-Rad |
1863024 |
|
|
|
|
|
|
| Critical Commercial
Assays |
| Neon Transfection System 100μl
Kit |
Thermo Fisher Scientific |
MPK10025 |
| MycoAlert Detection Kit |
Lonza |
LT07-318 |
| MycoAlert Assay Control Set |
Lonza |
LT07-518 |
| CFSE Cell Trace staining |
Thermo Fisher Scientific |
C34554 |
| Mouse Th1/Th2/Th17 Cytokine
Multi-Analyte ELISArray |
Qiagen |
MEM-003A |
| MaxPar Mouse Spleen/Lymph Node
Phenotyping kit |
Fluidigm |
201306 |
| MaxPar Mouse Intracellular Cytokine I
Panel kit |
Fluidigm |
201310 |
| Cisplatin viability dye |
Fluidigm |
201062 |
| Cytofix/Cytoperm Permeabilization
Solution kit |
BD Biosciences |
BDB554714 |
| Pierce BCA Protein Assay Kit |
Thermo Fisher Scientific |
23225 |
| Mouse IFN-gamma/Granzyme B Dual-Color
ELISpot Kit |
R&D Systems |
ELD5819 |
| Pan T-cell Isolation Kit II,
mouse |
Miltenyi Biotec |
130-095-130 |
| Anti-nuclear Antigen (IgG) mouse ELISA
Kit |
Antibodies-Online |
ABIN366290 |
| DNeasy Blood & Tissue kit |
Qiagen |
69504 |
|
|
|
| Deposited Data |
| TCRβ sequencing
tumor-infiltrating lymphocytes |
This paper |
immunoACCESS:
doi:10.21417/B7B648
|
| RNA-seq from human somatic/cancer cell
lines |
ENCODE project |
http://www.genome.gov/encode/ |
| RNA-seq from human iPS cells |
Churko
et al., 2017 |
|
| RNA-seq form murine somatic cell
lines |
ENCODE project |
http://mouseencode.org/ |
| RNA-seq from murine iPS cells |
Chang
et al., 2014 |
N/A |
|
|
|
|
|
|
| Experimental Models: Cell
Lines |
| EmbryoMax® Primary Mouse
Embryo Fibroblasts |
EMD Millipore |
PMEF-N |
| DB7 breast cancer cells |
The University of Utah; Dr. Joe
Smith |
|
| B16F0 melanoma cells |
ATCC |
CRL-6322 |
| AC29 mesothelioma cells |
Sigma Aldrich |
10092308 |
|
|
|
|
|
|
|
|
|
|
|
|
| Experimental Models:
Organisms/Strains |
| Mouse: FVB/NJ |
The Jackson Laboratory |
001800 |
| Mouse: C57BL/6J |
The Jackson Laboratory |
000664 |
| Mouse: CBA/J |
The Jackson Laboratory |
000656 |
| NOD-SCID IL2Rgammanull
(NSG) |
The Jackson Laboratory |
005557 |
|
|
|
|
|
|
| Oligonucleotides |
| TaqMan®Copy Number TFRC probe
(Mm00000692_cn) |
Thermo Fisher Scientific |
4400291 |
| 5’ACTAGCCAGAGGATCTTAAAGACT3’ |
This paper |
N/A |
| 5’GCCATCACTGGAAAGAGAGGC3’ |
This paper |
N/A |
|
This paper |
N/A |
|
|
|
|
|
|
| Recombinant DNA |
| Codon-optimized mini-intronic plasmid
(coMIP) |
Diecke
et al., 2015 |
N/A |
|
|
|
|
|
|
|
|
|
|
|
|
| Software and
Algorithms |
| ImmunoSeq Analyzer |
Adaptive Biotechnologies |
https://clients.adaptivebiotech.com/ |
| Prism GraphPad 7 |
GraphPad Software |
https://www.graphpad.com/scientific-software/prism/ |
| Cytobank |
Cytobank, Inc. |
https://stanford.cytobank.org/cytobank/login |
| Citrus 0.8 |
Nolan lab; Stanford, USA. |
https://github.com/nolanlab/citrus/wiki/Installing-Citrus |
| R; version 3.0.3 |
The R Project |
https://www.r-project.org/ |
| Adobe Photoshop CS6 |
Adobe |
http://www.adobe.com/nl/products/photoshop.html |
|
|
|
|
|
|
| Other |
| 29 Gauge x ” ½ needle
3/10cc |
Terumo Medical |
SS30M2913 |
| Multiplex-Luminex platform (LabMap200
System) |
HIMC; Stanford University, USA |
N/A |
|
|
|
|
|
|
|
|
|
