Table 1. Different PCR primers used in this study.

Genes	Primer sequences (5´-3´)	PCR Profile	Reference
16S	F: AGAGTTTGATCCTGGCTCAG R: AAGGAGGTGATCCAGCC	95°C for 5 min, followed by 30 cycles of 1 min at 94°C, 1min at 54°C and 1min at 72°C with final extension at 72°C for 10 min.	[36]
Gcd	F: GACCTGTGGGACATGGACGT R: GTCCTTGCCGGT GTAGSTCATC	94°C for 4 min, followed by 35 cycles of 1 min at 95°C, 1min at 56°C and 1min at 72°C with final extension at 72°C for 10 min.	[65]
pqqD and E	F: GGCTGCTGGCCGAACTGACTT R: GGCCGCAAGAAGCAT TATTAG	95°C for 5min, followed by 31 cycles of 1 min at 95°C, 1min at 55°C and 1min at 72°C with final extension at 72°C for 10 min.	[20]
pqqE	F: GARCTGACYTAYCGCTGYCC R: TSAGSAKRARSGCCTGR	95°C for 1 min, followed by 35 cycles at 94°C for 1 min, at 55°C for 1 min and at 72°C for 2 min, and a final step of 72°C for 10 min.	[66]
BOX	F: CTACGGCAAGGCGACGCTGACG	95°C for 1 min, followed by 35 cycles at 94°C for 1 min, at 55°C for 1 min and at 72°C for 2 min, and a final step of 72°C for 10 min	[67]

16S: 16S rRNA was used for phylogenetic analysis, gcd; glucose dehydrogenase gene, pqqE: gene for pqqE biosynthesis, pqqD&E: gene for pqqD&E biosynthesis, BOX: primers used for BOX-PCR analysis