Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Bioinformatics analysis of two novel mutations
| Novel mutation | Bioinformatics analysis | ||
|---|---|---|---|
| MutationTaster | Domain Type | ||
| prediction | Score | ||
| c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC, p.364_372del | disease causing | 0.999 | K-helix |
| c.1440_1447delinsTAAAAG, original stop codon lost, results in prolonged protein | disease causing | 0.999 | C-term |
MutationTaster Prediction: polymorphism or disease causing
