Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Details of predicted miRNAs for SbDREB2 genes using psRNATarget database
| Target gene | miRNA acc. | Expectation | miRNA sequence | Inhibition type |
|---|---|---|---|---|
| Sobic.009G101400.1 | sbi-miR6232a-5p | 4.5 | UACAUGGUUUUUUCAGUUUCGCUG | Cleavage |
| Sobic.009G101400.1 | sbi-miR437x-5p | 5 | UUUCAAACUGAAUCCUGUUGAGAU | Cleavage |
| Sobic.003G058200.1 | sbi-miR5568e-3p | 5 | UGCAAAAUCGAAAAGAUCUAU | Translation |
| Sobic.007G162700.1 | sbi-miR5385 | 5 | CUCUUCGCCACCCCAACCACCA | Translation |
| Sobic.001G378900.1 | sbi-miR5386 | 4.5 | GUCGCGCGCGCUGUCGCUGC | Cleavage |
