. 2018 Jul 13;6(3):69. doi: 10.3390/microorganisms6030069

Table 1.

Nucleotide sequence of primers used for the quantitative polymerase chain reaction (qPCR) assay.

Primer Name	Nucleotide Sequences (5′-3′)	Product Size	Position	Reference
F-Omt-1	GGCCGCCGCTTTGATCTAGG	123	^a 1485	[42]
R-Omt-1	ACCACGACCGCCGCC	123	1593	[42]
F-foxA	ACCGCAACCCTCTTCACATT	73	^b 1196	This study
R-foxA	AGACCGTGCAGGATAGGAGT	73	1268	This study
F-β-tub	TCTTCATGGTTGGCTTCGCT	98	^c 964s	This study
R-β-tub	CTTGGGGTCGAACATCTGCT	98	1042	This study

^a Positions are in accordance with the published sequence of the aflP (omt-1) gene of A. flavus (GenBank accession no. L25835.1). ^b Positions are in accordance with the published sequence of the foxA gene of A. flavus (GenBank accession no. XM_002377580). ^c Positions are in accordance with the published sequences of the β-tubulin gene of A. parasiticus (GenBank accession no. FR775333.1).