Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences for chromatin immunoprecipitation
| Name | Position relative to the transcriptional start site (+1) | Sequence (5′–3′) |
|---|---|---|
| TFAP4 intron 1 Fwd | +582 | CGCGACGTTTGTAAATTGC |
| TFAP4 intron 1 Rev | +726 | CTCAGATCCCGAGGAAGGA |
| TFAP4 intron 6 negative control Fwd | +14760 | TCTCAGTGGTTCGTCCCTGT |
| TFAP4 intron 6 negative control Rev | +14861 | GGAGGCGGTGTCAGAGGT |
| PTMA-positive control Fwd | - | ATCTTGTGTGGCACAGGT |
| PTMA-positive control | - | TCGTCTCTGGAGCCAGTTGG |
