REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rat anti-HA (3F10)	Roche	Cat#11867431001; RRID: AB_390919
Mouse anti-Myc (9E10)	Santa Cruz	Cat#sc-40; RRID: AB_627268
Rabbit anti-Myc	Sigma	Cat#C3956; RRID: AB_439680
Rabbit anti-GFP	Invitrogen	Cat#11122; RRID: AB_221569
Rabbit anti-pan-Nrx	Millipore	Cat#ABN161; RRID: AB_10917110
Rabbit anti-V5	Millipore	Cat#AB3792; PRID: AB_91591
Mouse anti-HS stub (3G10)	AMSBIO LLC	Cat# 370260; PRID: AB_10892311
Rabbit anti-β Actin	Abcam	Cat#ab8227; PRID: AB_2305186
Mouse anti-Bassoon	Stressgen	VAM-PS003; PRID: AB_10618753
Mouse anti-Synaptophysin	BD Transduction Laboratories	Cat# 611880; RRID: AB_399360
Rabbit anti-Synapsin I	Millipore	Cat#AB1543P; RRID: AB_90757
Mouse anti-vGlut1	NeuroMab	Cat#N28/9; RRID: AB_2187693
Mouse anti-PSD-95	Thermo Scientific	Cat#6G6-1C9; RRID: AB_325399
Guinea pig anti-VGAT	Millipore	Cat#AB5905; RRID: AB_2301751
Mouse anti-Gephyrin	Synaptic Systems	Cat#147021; RRID: AB_1279448
Chicken anti-MAP2	Abcam	Cat#ab5392; RRID: AB_2138153
Mouse anti-Tau	Millipore	Cat#PC1C6; RRID: AB_94855
Rabbit anti-HRP	Cedarlane	Cat#CL7802AP; RRID: AB_2736848
Mouse anti-Dlg	DSHB	Cat#4F3; RRID: AB_528203
Rabbit anti-vGlut1	Synaptic Systems	Cat#135303; RRID: AB_887876
Mouse anti-NeuN	Millipore	Cat#MAB377;RRID: AB_2298772
Bacterial and Virus Strains
AAV6-GFP-4xshRNA	This paper	N/A
AAV6-rNrx-TKD	This paper	N/A
Chemicals, Peptides, and Recombinant Proteins
CNQX	Abcam	Cat#ab120044
DL-APV	Abcam	Cat#ab120271
Bicuculline methiodide	Abcam	Cat#ab120109
Tetrodotoxin (TTX)	Abcam	Cat#ab120054
SR95531 hydrobromide (Gabazine)	Tocris	Cat#1262
(R)-CPP	Tocris	Cat#0247
Tetrodotoxin (TTX)	Tocris	Cat#1069
Nrx1α-AP-Myc-His	This paper	N/A
Nrx1α-ΔHS-AP-Myc-His	This paper	N/A
PTN-hFc	This paper	N/A
hFc	This paper	N/A
HA-NL1-His	This paper	N/A
HA-NL1-RA-His	This paper	N/A
LRRTM2-AP-Myc-His	This paper	N/A
LRRTM2-RA-AP-Myc-His	This paper	N/A
Nrx1β LNS-hFc (Nrx1β-hFc)	This paper	N/A
Critical Commercial Assays
Heparinase I	Sigma	Cat# H2519
Heparinase II	Sigma	Cat# H6512
Heparinase III	Sigma	Cat# H8891
Bacteroides Heparinase I	New England Biolabs	• Cat# P0735L
Bacteroides Heparinase II	New England Biolabs	• Cat# P0736L
Bacteroides Heparinase III	New England Biolabs	• Cat# P0737L
Heparin agarose	GE Healthcare	• Cat# 17-0406-01
BS3-d0 (bis(sulfosuccinimidyl) suberate-d0)	Thermo Fisher Scientific	Cat# 21590
Alexa Fluor 594 Hydrazide	Thermo Fisher Scientific	Cat# A10438
Experimental Models: Cell Lines
Human: HEK293 cells	ATCC	Cat#CRL-1573
Monkey: COS7 cells	ATCC	Cat#CRL-1651
Rat: embryonic day 18 cortical primary neuron culture	This paper	N/A
Rat: embryonic day 18 hippocampal primary neuron culture	This paper	N/A
Experimental Models: Organisms/Strains
Mouse: C57BL/6J	The Jackson Laboratory	JAX: 000664
Mouse: timed-pregnant female C57BL/6	Charles River	Strain code:027
Mouse: Nrxn1ΔHS	This paper	N/A
D. melanogaster w1118	Bloomington Drosophila Stock Center	Stock 3605
D. melanogaster dnrx273	(Li et al., 2007)	N/A
D. melanogaster dnrx241	(Li et al., 2007)	N/A
D. melanogaster Elav-Gal4	Bloomington Drosophila Stock Center	Stock 458
D. melanogaster UAS-Dnrx	This paper	N/A
D. melanogaster UAS-DnrxΔHS	This paper	N/A
Oligonucleotides
shRNA targeting sequence: Nrx1 Sh: GTGCCTTCCTCTATGACAACT	(Gokce and Südhof, 2013)	N/A
shRNA targeting sequence: Nrx2 Sh: GAACAAAGACAAAGAGTAT	(Gokce and Südhof, 2013)	N/A
shRNA targeting sequence: Nrx3 Sh: GGCCAGTGAATGAGCATTA	This paper	N/A
shRNA targeting sequence: GFP Sh: GGCGATGCCACCTACGGCAAG	(Alvarez et al., 2006)	N/A
shRNA targeting sequence: NL1 Sh: GGGAAGGGTTGAAGTTTGT	(Kwon et al., 2012)	N/A
shRNA targeting sequence: MorB Sh: GGGAAGGGTTGAAGTTTGT	(Alvarez et al., 2006)	N/A
Recombinant DNA
Nrx1α-CFP	(Siddiqui et al., 2010)	N/A
Nrx2α-CFP	(Siddiqui et al., 2010)	N/A
Nrx3α-CFP	(Siddiqui et al., 2010)	N/A
Amigo-CFP	(Siddiqui et al., 2010)	N/A
Nrx1β-CFP	(Graf et al., 2004)	N/A
Nrx1β-ΔLNS-CFP	(Graf et al., 2004)	N/A
Nrx1β-ΔCHO-CFP	(Graf et al., 2004)	N/A
Nrx1β-ΔCHObeg-CFP	(Graf et al., 2004)	N/A
Nrx1β-ΔCHOend-CFP	(Graf et al., 2004)	N/A
Nrx1β-SA(316)-CFP	This paper	N/A
Nrx1βSSAA(332,333)-CFP	This paper	N/A
Nrx1β-SSSAAA(316,332,333)-CFP	This paper	N/A
pLL3.7-hSyn-V5-Nrx1α	This paper	N/A
pLL3.7-hSyn-V5-Nrx1β	This paper	N/A
pAAV-hSyn-V5-Nrx2α	This paper	N/A
pAAV-hSyn-V5-Nrx2β	This paper	N/A
pAAV-hSyn-V5-Nrx3α	This paper	N/A
pAAV-hSyn-V5-Nrx3β	This paper	N/A
pLL3.7-hSyn-CFP-P2A-V5-Nrx1α	This paper	N/A
pLL3.7-hSyn-YFP-P2A-V5-Nrx1β	This paper	N/A
pLL3.7-hSyn-CFP-P2A-V5-Nrx1α-ΔHS	This paper	N/A
pLL3.7-hSyn-YFP-P2A-V5-Nrx1β-ΔHS	This paper	N/A
pcDNA3.1-Myc-Dnrx	This paper	N/A
pUASTattB-Myc-Dnrx	This paper	N/A
pcDNA3.1-Myc-Dnrx-ΔHS	This paper	N/A
pUASTattB-Myc-Dnrx-ΔHS	This paper	N/A
pNice-HA-NL1	(Scheiffele et al., 2000)	N/A
pNice-HA-NL2	(Scheiffele et al., 2000)	N/A
pNice-HA-NL3	(Graf et al., 2006)	N/A
pNice-HA-NL4	(Graf et al., 2006)	N/A
pNice-HA-NL1-51	This paper	N/A
pNice-HA-NL1-RA	This paper	N/A
pNice-HA-NL2-RA	This paper	N/A
pNice-HA-NL3-RA	This paper	N/A
pNice-HA-NL4-RA	This paper	N/A
HA-LRRTM2	This paper	N/A
HA-CD4	This paper	N/A
NGL-3-CFP	This paper	N/A
pCAGGS-Myc-LRRTM2	This paper	N/A
pCAGGS-Myc-LRRTM2-RA	This paper	N/A
pcDNA4- Nrx1α-PLAP-Myc-His	This paper	N/A
pcDNA4- Nrx1α-ΔHS-PLAP-Myc-His	This paper	N/A
PTN-hFc	This paper	N/A
pcDNA4-HA-ecto-NL1-His	This paper	N/A
pcDNA4-HA-ecto-NL1-RA-His	This paper	N/A
pcDNA4-HA-ecto-NL1-51-His	This paper	N/A
Nrx1β LNS-hFc/ Nrx1β-hFc	(Scheiffele et al., 2000)	Addgene# 59313
LRRTM2-PLAP-Myc-His	(Linhoff et al., 2009)	N/A
LRRTM2-RA-PLAP-Myc-His	This Paper	N/A
pFB-AAV-rNrx-TKD	This paper	N/A
pFB-AAV-GFP-4xshRNA	This paper	N/A
pLL3.7-U6-NL1-shRNA-hSyn-YFP	This paper	N/A
pLL3.7-U6-MORB-shRNA-hSyn-YFP	(Takahashi et al., 2011)	N/A
pFB-hSyn-DIO-YFP-P2A-HA-NL1∗	This paper	N/A
pFB-hSyn-DIO-YFP-P2A-HA-NL1∗-RA	This paper	N/A
pCMV6-HA-NL1∗	This paper	N/A
pCMV6-HA-NL1∗-RA	This paper	N/A
pFB-hSyn-DIO-GFP	This paper	N/A
pCAG-Cre	(Matsuda and Cepko, 2007)	Addgene# 13775
pSK(-)-pan-Nrxn1	This paper	N/A
pSK(-)-pan-Nrxn2	This paper	N/A
pSK(-)-pan-Nrxn3	This paper	N/A
Software and Algorithms
Pclamp 10.5	Molecular Devices	https://www.moleculardevices.com/products/axon-patch-clamp-system/acquisition-and-analysis-software/pclamp-software-suite
Fiji 64-bit (ImageJ2)	National Institute of Health	https://imagej.nih.gov/ij/index.html
GraphPad Prism 6	GraphPad Software Inc	https://www.graphpad.com/scientific-software/prism/
MATLab 2014a	MathWorks	https://www.mathworks.com/products/matlab.html
Clustal Omega	Clustal	http://www.clustal.org/omega/
Ilastik version 1.3.0	Ilastik.org	www.Ilastik.org
TrakEM2 1.0a	National Institute of Health	https://imagej.net/TrakEM2
Amira 5.6	Thermo Fisher Scientific	https://www.fei.com/software/amira-3d-for-life-sciences/