Table 1.
Oligonucleotide primers and probes of this study.
| Primer or probe | Sequence | Reference |
|---|---|---|
| gyrA fwd | CAGCCCTTCAATGCTGATG | Designed in the study |
| gyrA rev | CGCTTTTACTCCTTTTCTGTTC | Designed in the study |
| parC fwd | CTCAATCAGCGTAATCGCC | Designed in the study |
| parC rev | AATCCTCAGCCGATCTCAC | Designed in the study |
| Kpn.rpoBF1 fwd | GTCGCGGCTGAACAAGCT | Designed in the study |
| Kpn.rpoBR1 rev | AACGGCCACTTCGTAGAAGATC | Designed in the study |
| Kpn.rpoBP1-VIC probe | CTACGGCAGGTAACC | Designed in the study |
| oqxAF1 fwd | GTCGACGGCTTACAAAAAGTGTT | Designed in the study |
| oqxAR1 rev | GCAACGGTTTTGGCGTTAA | Designed in the study |
| oqxAP1-FAM probe | ATGCCGGGTATGCC | Designed in the study |
| oqxBF1 fwd | CTGGATTTTCCGTCCGTTTAAC | Designed in the study |
| oqxBR1 rev | TTGCCTACCAGTCCCTGATAGC | Designed in the study |
| oqxBP1-FAM probe | CTGCGCAGCTCGAA | Designed in the study |