REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Peroxidase-conjugated Goat anti-Mouse IgG (H+L)	Thermo Fisher Scientific	Cat#G-21040; RRID: AB_2536527
Peroxidase-conjugated Goat anti-Rabbit IgG (H+L)	Thermo Fisher Scientific	Cat#G-21234; RRID: AB_2536530
Rabbit Anti-Mouse IgG (H+L) Antibody, Alexa Fluor 546 Conjugated	Thermo Fisher	Cat#A11060; RRID: AB_2534107
Mouse anti-HA	Sigma	Cat#ROAHA Roche; RRID: AB_514505
Rabbit Anti-H4	Millipore	Cat#05-858; RRID: AB_390138
Rabbit Anti-H2A	Millipore	Cat#07-146; RRID: AB_11212920
Rabbit Anti-H4k5ac	Abcam	Cat#Ab51997; RRID: AB_2264109
Rabbit Anti-H3K9me3	Abcam	Cat#Ab8898; RRID: AB_306848
Rabbit Anti-H3K27me3	Abcam	Cat#Ab6002; RRID: AB_305237
Mouse Monoclonal anti-PCNA	Santa Cruz Biotechnology	Cat# sc-56; RRID: AB_628110
Mouse monoclonal anti-Histone H3	Abcam	Cat#ab10799; RRID: AB_470239
Mouse anti-RPA32	Abcam	Cat#ab2175; RRID: AB_302873
Rabbit polyclonal anti-POLE4	Bellelli et al., 2018	N/A
Mouse Monoclonal Anti-POLE2	Abcam	Cat#ab57298; RRID: AB_2166739
Rabbit polyclonal Anti POLE3	Bethyl	Cat#A301-245A; RRID: AB_890598
Rabbit polyclonal Anti POLE1	Genetex	Cat#GTX132100
Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody produced in mouse	Sigma	Cat#A8592; RRID: AB_439702
Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488-Conjugated	Thermo Fisher	Cat#A-21202; RRID: AB_141607
Chemicals, Peptides, and Recombinant Proteins
EDTA-free Complete protease inhibitor cocktail	Roche	Cat#COEDTAF-RO
EdU	Thermo Fisher Scientific	Cat#A10044
Biotin-Azide	Thermo Fisher Scientific	Cat#B10184
PhosSTOP phosphatase inhibitor cocktail	Roche	Cat#PHOSS-RO
Streptavidin Sepharose high performance	GE Healthcare	Cat#17-5113-01
CuSO4	Sigma	Cat#PHR1477
Ribonuclease A	Sigma	Cat# R5125
Sodium L-Ascorbate	Sigma	Cat#A7631
Propidium Iodide	Sigma	Cat# P4170
DNase I	New England BioLabs	Cat#M0303S
DAPI	Sigma	Cat#10236276001
Hydroxyurea	Sigma	Cat#H8627
Thymidine	Sigma	Cat#T9250
ANTI-FLAG M2 Affinity Gel	Sigma	Cat#A2220
Anti-HA Agarose	Thermo	Cat#26182
Glutathione-Sepharose 4B	GE Healthcare	Cat# 17-0756-01
Ni Sepharose 6Fast Flow	GE Healthcare	Cat# 17-5318-01
SNAP-Cell TMR-Star	New England Biolabs	Cat#S9106S
SNAP-Cell Block	New England Biolabs	Cat#S9105S
Topoisomerase I	Invitrogen	Cat#38042024
DSS (disuccinimidyl suberate)	Thermo	Cat#21655
Trypsin Gold Mass Spectrometry grade	Promega	Cat#V5280
SYBR Gold Nucleic Acid Gel Stain	Thermo Fisher	Cat#S11494
Prolong Gold antifade reagent with DAPI	Thermo Fisher	Cat#P36935
Critical Commercial Assays
Lipofectamine RNAiMAX	Thermo Fisher	Cat#13778150
Lipofectamine 2000	Thermo Fisher	Cat#11668027
Click-iT EdU Alexa Fluor 488 Flow Cytometry Assay Kit	Thermo Fisher	Cat#C10425
Experimental Models: Cell Lines
Mouse Embryonic Fibroblasts Pole4−/−	Bellelli et al., 2018	N/A
HeLa Trex POLE3 WT, POLE3ΔC and F44D mutants	This study	N/A
HeLa Trex POLE4 WT and F74D mutant	This study	N/A
HeLa SNAP-H3.1 and H3.3	Ray-Gallet et al., 2011	N/A
HeLa S3 FLAG-HA-H3.1 and H3.3	Tagami et al., 2004	N/A
U2OS GFP-RPA/RFP-PCNA	Mejlvang et al., 2014	N/A
Deposited Data
Mendeley Dataset	This paper	https://doi.org/10.17632/m5yk53pxt2.2
Oligonucleotides
ON-TARGETplus Non-targeting Control Pool	Dharmacon	Cat#D-001810-10
ON-TARGETplus CAF-1B siRNA	Dharmacon	Cat#L-019937-00-0005
ON-TARGETplus POLE1 siRNA	Dharmacon	Cat#L-020132-00
ON-TARGETplus POLE3 siRNA	Dharmacon	Cat#L-008460-01
ON-TARGETplus POLE4 siRNA	Dharmacon	Cat#L-009850-02
ON-TARGETplus POLE3 siRNA-Individual (siRNA POLE3 UTR)	Dharmacon	Cat#J-008460-10-0005
ON-TARGETplus POLE3 siRNA Individual (siRNA POLE3 CDS)	Dharmacon	Cat#J-008460-11-0005
Custom synthesized siRNA MCM2	Dharmacon	Sense Sequence GGAUGGAGAGGAGCUCAUUUU
Software and Algorithms
Adobe Photoshop CC	Adobe	https://www.adobe.com/es/products/photoshop.html
Adobe Illustrator CC	Adobe	https://www.adobe.com/uk/products/illustrator.html
ImageJ	NIH	https://imagej.nih.gov/ij/
GraphPad Prism 7	GraphPad	https://www.graphpad.com/
FlowJo	TreeStar	https://www.flowjo.com/solutions/flowjo/downloads
Volocity 6.3	PerkinElmer	http://www.perkinelmer.com/lab-products-and-services/cellular-imaging/index.html
CellProfiler	Broad Institute	http://cellprofiler.org/