TABLE 3.

Putative CREs within human RRAS promoter identified in silico

Strand	Start position	End position	Core similarity score	Matrix similarity score	CRE sequence, 5′–3′
+	−1843	−1823	1	0.907	CCGCGATGACGCCCCACAGTG
+	−1791	−1771	1	0.989	AGGAGGTGACGTAAGAGGCGC
−	−348	−328	1	0.756	TTCAGCAGACGGGGCGGAAAG

CREs were predicted using MatInspector from Genomatix. Position of CREs is relative to methionine start codon of Rras gene. Strands (+) and (−) are relative to same or opposite RRAS gene-carrying DNA strand, respectively. “Core sequence” of matrix is defined as (usually 4) consecutive highest conserved positions of matrix. Maximum core similarity of 1.0 is only reached when highest conserved bases of a matrix match exactly in sequence. Matrix similarity takes into account all bases over whole matrix length. Perfect match to matrix gets a score of 1.00 (each sequence position corresponds to highest conserved nucleotide at that position in matrix); good match to matrix usually has a similarity of >0.80. Source: https://www.genomatix.de/online_help/help/scores.html. In silico analysis identified 3 putative CREs (core sequence 5′-TGACG) within −1907/+1 region of human RRAS promoter. Core sequences are underlined.