Table 3.

Disease-causing pathogenic variants identified by WES in group 1, consisting of mitochondrial patients (MD).

	Family	Patients	Pediatric/ adult	Symptoms (key features)	Biochemistry (muscle or fibroblasts)	MDC Score	Orientation	Inheritance	Mito Carta	Gene (published by our group)	Pathogenic variant
Autosomal recessive, X-linked (consanguineous, >1 patient)	Non-consanguineous	3	p	Mitochondrial myopathy, hypertrophic cardiomyopathy	Combined OXPHOS deficiency	8	Compound heterozygous	AR	Yes	AARS2 (Kamps et al., 2018)	c.1774G>A, p.(Gly85Arg); c.938G>A, p.(Arg958*)
	Consanguineous	2 (partial overlap)	p	Multi-system, Leigh-like, encephalopathy, 3-methylglutaconic aciduria, aminoacylase 1 deficiency, skin lesions	Normal	8	Homozygous, homozygous, homozygous	AR, AR, AR	Yes, no, no	SERAC1, ACY1, ANTXR2 (Theunissen et al., 2017b)	c.1347_1349dup, p.(Ser450dup); c.811G>A, p.(Ala271Thr); c.1142A>G, p.(Tyr381Cys)
	Consanguineous	2	p	Encephalomyopathy, cerebellar atrophy, muscle weakness	CI deficiency	6	Homozygous	AR	Yes	SPG7	c.861dup, p.(Asn288*)
	Consanguineous	2	p	Leigh-like, mitochondrial encephalomyopathy	Combined OXPHOS deficiency	8	Homozygous	AR	Yes	FBXL4	c.851_852delCT, p.(Pro284Leufs*2)
	Non-consanguineous	3	p	Leigh-like, encephalomyopathy	Combined OXPHOS deficiency	7	Compound heterozygous	AR	Yes	MTFMT	c.160G>A, p.(Gly54Ser);c.626C>T, p.(Arg181SerfsX5)
	Consanguineous	1	p	Encephalopathy, lactic acidosis, pulmonary hypertension,	CI deficiency	5	Homozygous	AR	Yes	NDUFAF4	c.23G>A, p.(Gly8Asp)
	Consanguineous	2	p	Leigh syndrome, cardiomyopathy	Combined OXPHOS deficiency	5	Homozygous	AR	Yes	QRSL1 (Kamps et al., 2018)	c.850-3G>A, aberrant splicing of exon 8
	Consanguineous	1	p	Optic atrophy, cerebellar atrophy, hypotonia, increased blood lactate	CIV deficiency	8	Homozygous	AR	Yes	SLC25A46 (Nguyen et al., 2017)	c.283+3G>T, p.(Ser32Thrfs*4)
	Consanguineous	1	p	Hearing problems, muscle hypotonia, mitochondrial encephalopathy, motor developmental delay, respiratory problems, mtDNA depletion	CI and CIV deficiency	8	Compound heterozygous	AR	No	RRM2B	c.142C>T, p.(Gln48*); c.431C>T p.(Thr144Ile)
	Non-consanguineous	2	p	Axonal neuropathy, mild neurodegenerative disorder	Combined OXPHOS deficiency	5	Compound heterozygous	AR	Yes	COQ7	c.197T>A, p.(Ile66Asn); c.446A>G, p.(Tyr149Cys)
	Consanguineous	1 (6 miscar.)	p	Leigh-like, dystonia, motor developmental delay	CI deficiency	5	Homozygous	AR	Yes	NDUFAF5	c.477A>C, p.(Leu159Phe)
	Consanguineous	1	p	Optic neuropathy, failure to thrive, 3-methylglutaconic aciduria	CI deficiency	5	Homozygous	AR	Yes	TMEM126A	c.163C>T, p.(Arg55*)
	Consanguineous	3	p	Microcephaly, neurodegeneration, psychomotor retardation, cerebral visual impairment, hypotonia	CII and CIII deficiency	6	Homozygous	AR	Yes	PYCR2	c.796C>T, p.(Arg266*)
	Consanguineous	3	p	Leigh syndrome	Normal, decreased oxygen consumption	7	Homozygous	AR	No	SLC19A3 (Gerards et al., 2013)	c.20C>A, p.(Ser7*)
	Consanguineous	2	p	Leigh syndrome	Normal, decreased oxygen consumption	7	Homozygous	AR	No	SLC19A3 (Gerards et al., 2013)	c.20C>A, p.(Ser7*)
	Non-consanguineous	2	p	Psychomotor retardation, white matter degeneration, hypo-myelination, failure to thrive	CII and CIV deficiency	6	X-linked	AR	No	SLC16A2	c.427_430+19delGCAGGTGAGTGGCCCCGCACGCC, splice donor site intron 1 deleted
	Consanguineous	1	p	Leigh-like, white matter degeneration, epilepsy, dystonia, visual problems, increased blood lactate	n.d.	7	Homozygous	AR	No	IER3IP1	c.128G>T, p.(Gly43Val)
Autosmal recessive, X-linked, autosomal dominant (non-consanguineous, 1 patient)	Non-consanguineous	1	a	CPEO, deafness, multiple mtDNA deletions	n.d.	5	Compound heterozygous	AR	Yes	POLG1	c.752C>T, p.(Thr251Ile); c.1760C>T, p.(Pro587Leu)
	Non-consanguineous	1	p	Epilepsy, multiple mtDNA deletions	n.d.	5	Homozygous	AR	Yes	POLG1	c.1399G>A, p.(Ala467Thr)
	Non-consanguineous	1	p	Leigh syndrome	CI and CIII deficiency	6	Homozygous	AR	Yes	NDUFS7	c.364G>A, p.(Val122Met)
	Non-consanguineous	1	p	Cardiomyopathy, cerebellar atrophy	Combined OXPHOS deficiency	6	Compound heterozygous	AR	yes	MTO1	c.253G>A, p.(Gly85Arg); c.938G>A, p.(Arg313Gln)
	Non-consanguineous	1	a	Myopathy, ptosis, spinocerebellar ataxia, ragged red fibers	Normal	6	Compound heterozygous	AR	yes	SPG7	c.1529C>T, p.(Ala510Val), c.2090A>C, p.(Gln697Pro)
	Non-consanguineous	1	p	Leigh syndrome	CI deficiency	5	Homozygous	AR	yes	NDUFA12	c.83dup, p.(Arg29Glnfs*4)
	Non-consanguineous	1	p	SNHL, psychomotor retardation, spasticity, epilepsy	Decreased ATP production	5	Compound heterozygous	AR	yes	KARS	c.1732_1744delGGCATTGATCGAG, p.(Gly578Serfs*20); c.683C>T, p.(Pro228Leu)
	Non-consanguineous	1	p	Encephalopathy, white matter degeneration	CI deficiency	6	Homozygous	AR	yes	NDUFV2	c.547G>A, p.(Ala183Thr)
	Non-consanguineous	1	p	Leigh-like, microcephaly, mental retardation, CPEO, dystonia	Combined OXPHOS deficiency	6	Compound heterozygous	AR	yes	MTFMT	c.626C>T, p.(Ser209Leu); c.994C>T, p.(Arg332*)
	Non-consanguineous	1	p	Leigh-like, small cerebellum, high lactate	n.d	6	Compound heterozygous	AR	yes	FBXL4 (van Rij et al., 2016)	c.292C>T, p.(Arg98*); c.1303C>T, p.(Arg435*)
	Non-consanguineous	1	p	Myopathy, muscle weakness, visual problems, mental retardation, peripheral neuropathy, mtDNA depletion	n.d.	6	Homozygous	AR	no	C19orf12	c.187G>C, p.(Ala63Pro)
	Non-consanguineous	1	p	Exercise intolerance, muscle weakness	CI deficiency	5	Homozygous	AR	yes	TMEM126B (Theunissen et al., 2017a)	c.635G>T, p.(Gly212Val)
	Non-consanguineous	1	p	Leigh syndrome, liver failure	CI and CIV deficiency	6	Homozygous	AR	yes	TRMU	c.1073_1081dup, p.(Gln358_Val360dup); deletion exon 2-11
	Non-consanguineous	1	p	Mental retardation, ataxia, exercise intolerance, 3-methylglutaconic aciduria	CV deficiency	7	Homozygous	AR	yes	ATPAF2	c.281G>C, p.(Trp94Ser)
	Non-consanguineous	1	a	Leigh-like, optic atrophy, exercise intolerance	n.d.	7	Homozygous	AR	yes	AMACR	c.154T>C, p.(Ser52Pro)
	Non-consanguineous	1	p	Optic atrophy, muscle weakness, polyneuropathy	combined OXPHOS deficiency	5	Homozygous	AR	yes	C12ORF65	c.394C>T, p.(Arg132*)
	Non-consanguneous	1	p	Muscle weakness, cardiomyopathy, high lactate, 3-methylglutaconic aciduria	n.d.	7	X-linked	AR	no	TAZ	c.646G>A, p.(Gly216Arg)
	Non-consanguineous	1	p	Cerebellar atrophy, ataxia, mental retardation, white matter abnormalities, axonal peripheral sensorimotor neuropathy	n.d.	5	de novo	AD	yes	MFN2	c.1058C>T, p.(Ala353Val)
	Non-consanguineous	1	a	Cardiac arrhythmia, CPEO, polyneuropathy, multiple mtDNA deletions	CII and CIV deficiency	5	unknown#	AD	yes	twinkle (c10orf2)	c.1087T>C, p.(Trp363Arg)
	Non-consanguineous	1	p	Arthrogryposis, foot deformities, muscle fat depositions, oculocutaneous albinism	CIV deficiency	6	de novo, compound heterozygous	AD, AR	no, no	BICD2, HPS1 (Theunissen et al., 2017b)	c.539A>C, p.(Asp180Ala); c.517C>T, p.(Arg173*); c.1189delC, p.(Gln397Serfs*2)
	Non-consanguineous	1	p	Lung fibrosis, growth retardation, muscle weakness, failure to thrive, hepathopathy	CI deficiency	7	Compound heterozygous	AR	no	IARS	c.3377dup, p.(Asn1126Lysfs*9); c.1305G>C, p.(Trp435Cys)
	Non-consanguneous	1	p	CPEO, mitochondrial myopathy, COX negative fibers	CIII deficiency	5	Compound heterozygous	AR	no	CHRNE	c.1327delG, p.(Glu443Lysfs*64); c.1429delG, p.(Ala477Profs*30)

Overview of the gene defects identified by WES in 94 patients, of which 39 had a probable mitochondrial disease. Patients were grouped according to the applied WES-data filtering strategy. AR = autosomal recessive, AD = autosomal dominant, D, dominant; ‘green’ marked genes, genes with a reported mitochondrial function or localization in literature (except for ACY1, ANTXR2, which were part of a multi-genic disease); ‘purple’ marked genes, genes previously related to possibly secondary OXHPHOS deficiencies; ‘red’ marked genes, no mitochondrial localization or function reported; ∧, subclinical symptoms in parent revealed after follow-up investigations; #, no parental DNA available.