Table 2.
Primer sequences used for qRT-PCR
| Name | Primer sequence (5′-3′) |
|---|---|
| TGEV-N | F: caattcccgtggtcggaaga |
| R: tttacgttggcccttcacca | |
| GAPDH | F: tcatcatctctgccccttct |
| R: gtcatgagtccctccacgat |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.