Table 1: List of sgRNA sequences used in line creation.

Underlined letters denote mismatches between target sequence and the Bsal cloning site of the pDR274 cloning vector. Bolded Letters denote the protospacer-adjacent motif (PAM) site. Italicized letters denote the portion of the oligo specific to the BsaI of pDR274.

sgRNA designation	Target Sequence	Forward Oligo (5’−3’)	Reverse Oligo (5’−3’)	Successful?
NETsg1	agcgtcagtctctcattttctgg	taggcgtcagtctctcattttc	aaacgaaaatgagagactgacg	No
NETsg2	tcatggacacgcctccaagtcgg	taggatggacacgcctccaagt	aaacacttggaggcgtgtccat	Yes
sgM	ggctgctgcggttccagagg	n/a	n/a	Yes