Table 2. The seven selected genes associated with immune response in fish species (according to [21, 22, 23, and 24]) and the three reference genes: Function of immune relevant genes, designed RT-qPCR primers, product size (bp), annealing temperature (Ann. Temp.) and temperature for fluorescence acquisition (Fluor. Temp.).

Gene	Function	Primers (5' - 3')	Size (bp)	Ann. Temp. (°C)	Fluor. Temp. (°C)
Barrier-to-autointegration factor	early response gene to viral infections	F: gccgcaggctagaggagaag	116	57	80
BAF		R: ggcccctgtggtatttttca
C-C motif chemokine 19 CCL19	recruiting monocytes, neutrophils, and other effector cells from vessels towards the focus of infection	F: ctcctgccaccaagaacaac	119	57	78
		R: acccacagcctttcagtgtc
NOD-like receptor family CARD NLRC5	recognition of microbial pathogens	F: acctgacccatgaggatgga	217	57	82
		R: gcagcaagcccacaaaacat
Interferon regulatory factor 1 IRF-1	modulating the expression of interferon genes	F: gctgctctgtgacagttgga	105	60	75
		R: gcacgatttaacaaaagagtggat
Interferon alpha 1 IFN-a1	signaling pathways in response to pathogen infection or pathogen associated molecular pattern stimulation	F: acagcgaaacaaacagctattt	89	57	73
		R: gacacacgctctgcatactg
Interferon gamma IFN-g	signaling pathways in response to pathogen infection or pathogen associated molecular pattern stimulation	F: actgaaagtccactataagatctc	370	57	83
		R: tggaacttaagggccagtttg
Major histocompatibility complex I MHC-I	initiating CD8+ cytotoxic T cell-mediated cellular immunity	F: tgaagccatcaaaacaacca	138	60	75
		R: gagcaaagatcgaacatgtca
60S ribosomal protein L28		F: catccgcaagagcaactaca	101	60	83
		R: cctcttcaccaccaccacac
40S ribosomal protein S10		R: cccaagaagaaccgtattgc	121	60	80
		R: gaaggttgggcacgttctt
Ubiquitin		F: cttcatcttgtgctgcgtct	147	60	82
		R: acacttcttcttgcggcagt