REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-mouse NLRP3	Adipogen	Cat# AG-20b-0014
Anti-mouse caspase-1 p20	Adipogen	Cat# AG-20B-0042
Anti-mouse calpain 1	Cell Signaling Technology	Cat# 2556; RRID: AB_2290836
Anti-mouse calpain 2	Cell Signaling Technology	Cat# 2539; RRID: AB_2069843
Anti-β Actin	Cell Signaling Technology	Cat# 4970; RRID: AB2223172
Anti-human IL-1β	Cell Signaling Technology	Cat# 12703
Anti-GAPDH	Cell Signaling Technology	Cat# 2118; RRID: AB_561053
Anti-mouse Myosin IIa	Cell Signaling Technology	Cat# 3403S; RRID: AB_2147297
Anti-mouse Flightless-1	Santa Cruz	Cat# SC-55583; RRID: AB_831341
Anti-human Caspase-1	Santa Cruz	Cat# SC-622; RRID: AB_2069053
Anti-mouse ASC	Santa Cruz	Cat# SC-22514-R; RRID: AB_2174874
Anti-mouse IL-1β antibody	R&D	Cat# AF-401-NA; RRID: AB_416684
HRP-conjugated goat anti-rabbit IgG	Cell Signaling Technology	Cat# 7074s; RRID: AB_2099233
HRP-conjugated horse anti-mouse IgG	Cell Signaling Technology	Cat# 7076s; RRID: AB_330924
HRP-conjugated donkey anti-goat IgG	Santa Cruz	Cat# SC-2020; RRID: AB_631728
All the fluorescent secondary antibodies	Jackson ImmunoResearch	N/A
Chemicals, Peptides, and Recombinant Proteins
Al(OH)3	Sigma	Cat# V900163
Calcium pyrophosphate	Sigma	Cat# 401552
Uric acid	Sigma	Cat# U2625
ATP	Sigma	Cat# A2383
PMA	Sigma	Cat# P1585
Glyburide	Sigma	Cat# G2539
CFTRinh-172	Sigma	Cat# C2992
Monosodium urate (MSU) crystals	(Shi et al., 2003)	N/A
GlyH-101	TargetMol	Cat# T2451
Calpeptin	Selleck	Cat# S7396
Nigericin	Tocris	Cat# 4312
PD150606	Tocris	Cat# 1269
2-APB	Tocris	Cat# 1224
E. coli 0111:B4 LPS	Sigma	Cat# L4391
Naked poly(dA:dT)	Invivogen	Cat# tlrl-patn
Ultrapure Flagellin	Invivogen	Cat# tlrl-epstfla-5
Murine GM-CSF	PeproTech	Cat# AF-315–03
Murine IL-4	PeproTech	Cat# AF-214–14
DiBAC4(5)	AAT Bioquest	Cat# 21410
DSS	Thermo	Cat# 21555
CMAC peptidase substrate (t-BOC-Leu-Met)	Thermo	Cat# A6520
MQAE fluorescent probe	Beyotime	Cat# s1082
Critical Commercial Assays
LDH release detection kit	Beyotime	Cat# c0016
Mouse IL-1β ELISA ready-set-go kits	eBioscience	Cat# 50–171-85
Mouse TNFα ELISA ready-set-go kits	eBioscience	Cat# 50–173-31
Mouse IL-6 ELISA ready-set-go kits	eBioscience	Cat# 50–112-8696
Human IL-1β ELISA ready-set-go kits	eBioscience	Cat# 50–112-5196
Human TNFα ELISA ready-set-go kits	eBioscience	Cat# 50–173-66
Experimental Models: Cell Lines
Human: HEK293FT	Dr.Wei Guo’s Lab	N/A
Human: THP-1	ATCC	ATCC: TIB-202
Mouse: L929	ATCC	ATCC: CCL-1
Experimental Models: Organisms/Strains
C57BL/6 mice	The Jackson Laboratory	JAX 000664
Oligonucleotides
gRNA targeting sequence: CAPN1 atcacgccggtgtactgcactgg, and tgggaccctcttccgtgatgagg.	This paper	N/A
qPCR primers for mouse Flightless-1: 5’-tctgcagaagctggagcac-3’ and 5’-ttggcccgagctacaatg-3’	This paper	N/A
qPCR primers for mouse Nlrp3: 5’-gaattccggccttacttcaa-3’ and 5’-ggtgtgtgaagttctggttgg-3’	This paper	N/A
qPCR primers for mouse II-1b: 5’-ttgacggaccccaaaagat-3’ and 5’-gaagctggatgctctcatctg-3’	This paper	N/A
qPCR primers for human CAST: 5’-aaccagccacggataaagatg-3’ and 5’-agcagcggccttagattcttc-3’	This paper	N/A
Non-targeting shRNA: Misson pLKO.1- puro Control Vector, TRC1.5 Negative Controls	Sigma	SHC002
Non-targeting shRNA: TRC2 Transduction Control, DNA, PLKO-PUR, TRC2 Negative Controls	Sigma	SHC202
shRNA sequence: CAST #1	Sigma	TRCN0000073638
shRNA sequence: CAST #2	Sigma	TRCN0000073642
shRNA sequence: CAPN1	Sigma	TRCN0000003559
shRNA sequence: CAPN2	Sigma	TRCN0000003539
Software and Algorithms
FlowJo_V10.0.8	FlowJo, LLC	https://www.flowjo.com
Graphpad Prism 6 software	Graphpad Prism	N/A
Adobe Illustrator CC 2015	Adobe	N/A
ImageJ	NIH	https://imagej.nih.gov/ij/download.html
Cleavage site prediction algorithm (GPS-CCD 1.0)	(Liu et al., 2011)	http://ccd.biocuckoo.org/down.php