REAGENT or RESOURCE | SOURCE | IDENTIFIER |
Antibodies | ||
CD117 APC | BD Biosciences | Cat#553356 |
Ly-6A/E APC-Cy7 | BD Biosciences | Cat#560654 |
CD34 FITC | BD Biosciences | Cat#553733 |
CD16/CD32 PE-Cy | eBiosciences | Cat#25-0161 |
Ly-6G and Ly-6C Biotin | BD Biosciences | Cat#553124 |
Cd11b Biotin | BD Biosciences | Cat#553309 |
CD45R/B220 Biotin | BD Biosciences | Cat#553086 |
CD3e Biotin | eBiosciences | Cat#13-0037-82 |
Ter119 Biotin | BD Biosciences | Cat#553672 |
Streptavidin eFluor® 450 | eBiosciences | Cat#48-4317-82 |
CD11b PE | BD Biosciences | Cat#555388 |
CD15 APC | BD Biosciences | Cat#561716 |
CD117 APC | BD Biosciences | Cat#553356 |
RUNX1 polyclonal | Abcam | Cat#ab23980 |
H3K27ac polyclonal | Abcam | Cat#ab4729 |
H3K4me1 polyclonal | Abcam | Cat#ab8895 |
H3k27me3 monoclonal | Abcam | Cat#ab6002 |
BRG1 monoclonal | EPITOMICS | Cat#2822-1 |
RING1B polyclonal | Abcam | Cat#ab3832 |
MYC polyclonal | Santa Cruz | Cat#N-262 |
p300 polyclonal | BETHYL | Cat#A300-358A |
GAPDH monoclonal | Cell Signaling | Cat#3683 |
Biological Samples | ||
human AML samples | UPENN | N/A |
human AML samples | University Hospital Heidelberg | N/A |
human cord blood | UMASS | N/A |
Chemicals, Peptides, and Recombinant Proteins | ||
AI-10-49 | John Bushweller | N/A |
JQ1 | James Bradner | N/A |
JQ1 | ApexBio | Cat#A1910 |
PRT 4165 | Tocris Bioscience | Cat#5047 |
pIpC | GE healthcare | Cat#27-4732-01 |
4-Hydroxytamoxifen | Sigma | Cat#H7904 |
Recombinant Human IL-3 | Peprotech | Cat#200-03 |
Recombinant Human IL-6 | Peprotech | Cat#200-06 |
Recombinant Human FLT3L | Peprotech | Cat#300-19 |
Recombinant Human SCF | Peprotech | Cat#300-07 |
Recombinant Human TPO | Peprotech | Cat#300-18 |
Recombinant Murine IL-3 | Peprotech | Cat#213-13 |
Recombinant Murine IL-6 | Peprotech | Cat#216-16 |
Recombinant Murine SCF | Peprotech | Cat#250-03 |
Critical Commercial Assays | ||
PureLink® RNA Mini Kit | Life Technologies | Cat#12183018A |
SUPERSCRIPT III | Thermo Fisher Scientific | Cat#18080-044 |
Power SYBR® Green PCR Master Mix | Applied Biosystems | Cat#4367659 |
Annexin V Apoptosis Detection Kit | BD Biosciences | Cat#559763 |
NE-PER™ Nuclear and Cytoplasmic Extraction Reagents | Thermo Fisher Scientific | Cat#78833 |
CellTiter 96® AQueous One Solution Cell Proliferation Assay | Promega | Cat#G3580 |
True seq Nano DNA LT kit | Illumina | Cat#15041757 |
Nextera DNA Sample Preparation Kit | Illumina | Cat#FC-121-1030 |
KAPA Genotyping kit | Kapabiosystems | Cat#KK7352 |
TruSeq RNA library kit | Illumina | Cat#RS-122-2001 |
CD34 MicroBead Kit | Milteny Biotec | Cat#130-046-702 |
EasySep® Mouse Hematopoietic Progenitor Cell Enrichment Kit | Stemcell Technologies | Cat#19756 |
Amaxa® Cell Line Nucleofector® Kit V | Lonza | Cat#VCA-1003 |
Deposited Data | ||
SuperSeries of RNA-seq, ChIP-seq, ATAC-seq and 5C | This paper | GEO: GSE101791 |
RNA-seq in ME-1 cells | This paper | GEO: GSE101788 |
ChIP-seq in ME-1 cells | This paper | GEO: GSE101789 |
ATAC-seq in ME-1 cells | This paper | GEO: GSE101790 |
5C in ME-1 cells | This paper | GEO: GSE109764 |
ChIP-seq in ME-1 cells | Mandolli et al., 2014 | GEO: GSE46044 |
ChIP-seq in K562 cells | Pugacheva et al., 2015 | GEO: GSE70764 |
Experimental Models: Cell Lines | ||
Human: ME-1 cells | DSMZ | Cat#ACC 537 |
Human: U937 cells | ATCC | Cat#CRL-1593.2 |
Human: K562 cells | ATCC | Cat#CCL-243 |
Human: Jurkat cells | DSMZ | Cat#ACC-282 |
Human: Kasumi-1 cells | ATCC | Cat#CRL-2724 |
Human: THP-1 cells | ATCC | Cat#TIB-202 |
Human: NB4 cells | DSMZ | Cat#ACC-207 |
Human: MV4:11 cells | ATCC | Cat#CRL-9591 |
Human: 293T/17 cells | ATCC | Cat#CRL-11268 |
Experimental Models: Organisms/Strains | ||
C57BL/6J | Taconic Biosciences | N/A |
Oligonucleotides | ||
ChIP-qPCR Primers (See Table S2) | This paper | N/A |
RT-PCR Primer (See Table S2) | This paper | N/A |
sgRNA (See Table S2) | This paper | N/A |
CUT&RUN Primer (See Table S2) | This paper | N/A |
ATAC-qPCR Primer (See Table S2) | This paper | N/A |
shRNA (See Table S2) | This paper | N/A |
Recombinant DNA | ||
Plasmid: shRNA MYC4 | UMMS RNAi Core Facility | Cat#TRCN0000174055 |
Plasmid: shRNA MYC6 | UMMS RNAi Core Facility | Cat#TRCN0000010390 |
Plasmid: pLKO.1 puro | Sigma | Cat#SHC002 |
Plasmid: shRNA Myc1 (Myc1891) CTCGAGAAGGTATATTGCTGTTGACA GTGAGCGCACGACGAGAACAGTTG AAACATAGTGAAGCCACAGATGTAT GTTTCAACTGTTCTCGTCGTTT GCCTACTGCCTCGGAATTC |
Zuber et al., 2011b | N/A |
Plasmid: shRNA-Myc2 (Myc2105) CTCGAGAAGGTATATTGCTG TTGACAGTGAGCGCCTGCC TCAAACTTAAATAGTATAGTGAAGCCA CAGATGTATACTATTTAAGTTTGA GGCAGTTGCCTACTGCCTCGGAATTC |
Zuber et al., 2011b | N/A |
Plasmid: shRNARen (Ren713) TGCTGTTGACAGTGAGCGCAGGAA TTATAATGCTTATCTATAG TGAAGCCACAGATGTATAGATA AGCATTATAATTCCTAT GCCTACTGCCTCGGA |
Zuber et al., 2011b | N/A |
Plasmid: pLKO. 1 - TRC cloning vector | Moffat et al., 2006 | Addgene#10878 |
Plasmid: psPAX2 | Trono Lab Packaging and Envelope Plasmids (unpublished) | Addgene#12260 |
Plasmid: pMD2.G | Trono Lab Packaging and Envelope Plasmids (unpublished) | Addgene#12259 |
Plasmid: pLentiCRISPRv2 | Sanjana et al., 2014 | Addgene#52961 |
Plasmid: pDecko-mCherry | Pulido-Quetglas et al., 2017 | Addgene#78534 |
Plasmid: MYC-ER | Ricci et al., 2004 | Addgene#19128 |
Software and Algorithms | ||
Bioconductor v3.4 | http://www.bioconductor.org | |
ChIPpeakAnno v3.9 | Zhu, 2013; Zhu et al., 2010 | https://bioconductor.org/packages/release/bioc/html/ChIPpeakAnno.html |
ATACseqQC v1.0.3 | Bioconductor package | https://bioconductor.org/packages/release/bioc/html/ATACseqQC.html |
Bowtie2 v2.1.0 | Langmead and Salzberg, 2012 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
MACS2 v2.1.0 | Zhang et al., 2008 | https://github.com/taoliu/MACS |
FastQC v0.10.1 | Babraham Bioinformatics | https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ |
Tophat v2.0.9 | Trapnell et al., 2009 | https://ccb.jhu.edu/software/tophat/index.shtml |
Cufflinks v2.2.0 | Trapnell et al., 2012 | http://cole-trapnell-lab.github.io/cufflinks/ |
Diffbind v2.4.8 | Ross-Innes et al., 2012 | https://bioconductor.org/packages/release/bioc/html/DiffBind.html |
Picard tools 1.96 | Broad Institute | https://broadinstitute.github.io/picard/ |
Bedtools v1.25.0 | Quinland et al., 2010 | http://bedtools.readthedocs.io/en/latest/ |
Fastx-toolkit v.0.0.18 | Hannon Laboratory | http://hannonlab.cshl.edu/fastxtoolkit/ |
GSEA | Broad Institute | http://software.broadinstitute.org/gsea/index.jsp |
Molecular Signatures Database v6.0 | Broad Institute | http://software.broadinstitute.org/gsea/msigdb/index.jsp |
GraphPad Prism 6.0 | GraphPad | https://www.graphpad.com |
FlowJo Software | FlowJo LLC | https://www.flowjo.com |
Other | ||
RPMI 1640 Medium | Thermo Fisher Scientific | Cat#A10491-01 |
Fetal Bovine Serum, Charcoal Stripped | Sigma | Cat#F6765 |
StemSpan SFEM II | STEMCELL Technologies | Cat#09605 |
StemSpan SFEM | STEMCELL Technologies | Cat#09650 |
RBC Lysis Solution | 5 Prime | Cat#2301310 |
MethoCult | STEMCELL Technologies | Cat#M3534 |
Effectene | Qiagen | Cat#301425 |
Fugene 6 Transfection Reagent | Promega | Cat#E2691 |
Dynabeads® Protein G | Thermo Fisher Scientific | Cat#10004D |
Dynabeads® Protein A | Thermo Fisher Scientific | Cat#10002D |
Dynabeads™ MyOne™ Streptavidin C1 | Thermo Fisher Scientific | Cat#65001 |
Agencourt AMPure XP 5 mL Kit | Beckman Coulter | Cat#A63880 |
Bio-Mag Plus Concanavalin A coated beads | Polysciences | Cat#86057 |
Protein A-MNase | Skene et al., 2015 | N/A |
Plamsmocin | Invivogen | Cat#ant-mpt |
Retro-X Concentrator | Clontech | Cat#631455 |
Lenti-X Concentrator | Clontech | Cat#631231 |
Halt™ Protease Inhibitor Cocktail | Thermo Fisher Scientific | Cat#778429 |
Proteinase K (Fungal) | Thermo Fisher Scientific | Cat#25530-031 |
T4 polynucleotide kinase | New England Biolabs | Cat#M0201 |
Q5® High-Fidelity DNA Polymerase | New England Biolabs | Cat#M0491L |
HindIII | New England Biolabs | Cat#R0104S |
Dounce homogenizer, pestle A | Kimble Chase | Cat#885301-0002 |
Amicon® Ultra - 0.5ml-30K | Millipore | Cat#UFC5030BK |
T4 DNA ligase | Thermo Fisher Scientific | Cat#15224 |
Taq DNA ligase and buffer | New England Biolabs | Cat#M0208S |
Salmon testes DNA | Sigma | Cat#D7656 |
QIAquick gel extraction kit | Qiagen | Cat#28704 |
4-Thiouridine | Carbosynth | Cat#NT06186 |
EZ-Link™ HPDP-Biotin | Thermo Fisher Scientific | Cat#21341 |
T4 PNK (10 U/μL) | New England Biolabs | Cat#M0201S |
T4 DNA polymerase | Thermo Fisher Scientific | Cat#18005025 |
Taq DNA polymerase | Thermo Fisher Scientific | Cat#EP0401 |
2× Rapid DNA ligase buffer | Enzymatics | Cat#B101L |
Enzymatics DNA ligase | Enzymatics | Cat#L6030-HC-L |
5× KAPA buffer | Kapabiosystems | Cat#KK2502 |
KAPA HS HIFI polymerase | Kapabiosystems | Cat#KK2502 |
Clean-Blot IP Detection Reagent | Thermo Fisher Scientific | Cat#21230 |