Table 2.
Primers used to amplify halI and halR genes by PCR.
Primer | Sequence (5'-3') | Application |
---|---|---|
halI-F | AACTGATTACACCAATGCAGT | Amplification of halI |
halI-R | GGAATGCTTGAACTATTTGATG | Amplification of halI |
halI-bam | ATTGGATCCTACACCAATGCAGTCTTAATT | Amplification of halI gene and preparation for cloning in pQE-30Xa |
halI-sac | ATTGAGCTCATGCTTGAACTATTTGATGTC | Amplification of halI gene and preparation for cloning in pQE-30Xa |
halR-F | CTT CAG GGA TGC CAT ATG TTT | Amplification of halR |
halR-R | ACT GCA TTG GTG TAA TCA GTT | Amplification of halR |
The introduced restriction sites for BamHI and SacI are underlined.