Cloning and expression of a transcription factor activator protein-1 member identified from the swimming crab Portunus trituberculatus

Abstract

Transcription activator proteins are regulatory proteins that bind to the promoter regions of target genes. Transcription activator protein-1 (AP-1) regulates numerous genes related to the immune system, apoptosis, and proliferation. In this study, the full-length cDNA of AP-1 from Portunus trituberculatus (PtAP-1) was identified by expressed sequence tag analysis and cDNA-end rapid amplification. The gene is 1183 bp and encodes a 256-amino acid protein with a predicted molecular mass and isoelectric point of 28.96 kDa and 8.90, respectively. PtAP-1 showed the highest expression level in the gonad tissue and the lowest expression level in blood, hemocyte, muscle, hepatopancreas, and gill, during the first 6 h of low-salinity stimulation (10%). Additionally, we observed steady decreases in PtAP-1 mRNA expression in the gill, but at 12 h, expression was initially upregulated, followed by a significant decrease until restoration to baseline levels at 48 h. Additionally, Vibrio alginolyticus challenge resulted in significant upregulation of PtAP-1 expression in the first 6 h, which was maintained at high levels for 48 h. From 48 to 72 h, we observed decreases in PtAP-1 levels, although they remained significantly higher than those detected at baseline. These results suggested that PtAP-1 is involved in the immune response and osmoregulation of crustaceans.

Introduction

Transcription factors are regulatory proteins that govern transcription inhibition or activation (De Zoysa et al. 2010) by binding to specific DNA sequences located in downstream promoter regions to control gene expression. Activating protein 1 (AP-1) is an important transcription factor and a member of a family of transcription factors that contain basic leucine zipper (bZIP) domains necessary for dimerization and DNA binding (Eychène et al. 2008; Schuermann et al. 1989). The major AP-1 subfamilies include Jun, Fos, and activating transcription factor proteins (Eychène et al. 2008; Karin and Liu 1997; Kamei et al. 1996).

Transcription factor AP-1 is a kind of chimeric protein of dimer complex, which consists of Jun (c - jun, JunB, JunD), Fos (c-fos, Fra-1, Fra-2, FosB), and atf protein, coded by proto-oncogenes jun, fos, and active transcription factor atf subunit gene, respectively, meanwhile, and AP-1 in working order in the form of homologous or heterologous Jun-Jun, Jun-Fos, and Jun-Atf (De Zoysa et al. 2010; Shaulian 2010; Vesely et al. 2009; Karin 2001; Halazonetis et al. 1988). This complex can bind to promoter and enhancer regions of target genes with high affinity, thereby regulating gene expression (Eriksson et al. 2010; Abate et al. 1991; Curran and Franza 1988). The broad spectrum of AP-1 proteins results in their binding affinity and specificity, as well as their regulation of multiple genes (Wagner and Eferl 2005; Curran and Franza 1988). Previous studies reported AP-1 involvement in wound healing, differentiation, cellular migration, immune responses, apoptosis, and inflammation (Wagner and Eferl 2005). Moreover, AP-1 as a regulator of cell life and death regulates gene expression in response to various stimuli, including stress conditions, growth factors, cytokines, and bacterial or viral infections (Zhou et al. 2018; Wu et al. 2015; Shaulian and Karin 2002). However, the molecular features and expression of AP-1 of crustaceans are seldom studied. The clone and expression profile analysis of AP-1 gene from Pacific white shrimp (Litopenaeus vannamei) has been carried out, indicating that AP-1 gene took part in shrimp innate immune response caused by WSSV (Wu et al. 2014). However, up to now, AP-1 has not yet been identified in Portunus trituberculatus.

The swimming crab (Portunus trituberculatus) is an important marine aquaculture species in China and yielded > 125,317 tons in 2016 (China fishery statistical yearbook 2017). However, disease, especially bacterial infections, has caused serious losses to the P. trituberculatus cultivation industry (Xia et al. 2018; Fu et al. 2016; Wang et al. 2007). Vibriosis is the main cause of high mortality of P. trituberculatus, especially in the summer when rain results in lower salinity in crab ponds (Ye et al. 2016). Without an acquired immune system, crabs defend against invading microorganisms solely with their innate immune system (Shentu et al. 2015; Wang et al. 2018). AP-1 is involved in the regulation of a variety of immune-related genes as a central transcription factor. Therefore, identification of crab AP-1 is important in order to improve the understanding of innate immune defense mechanisms in order to develop corresponding disease-control strategies. In this study, we cloned the full-length cDNA of P. trituberculatus AP-1 (PtAP-1) and evaluated its spatiotemporal-expression profile following exposure to bacterial challenge and low-salinity stress in order to clarify its immunoregulatory functions.

Methods

Experimental animals, bacterial challenge, and low-salinity stress

Crabs (P. trituberculatus; 151 ± 25 g) were purchased from a crab farm in Zhejiang Province, China, and cultured at between 17 and 19 °C in aerated tanks for 7 days prior to experiments. The crabs were fed razor clams and maintained in seawater (salinity 26%); 50% of which was changed daily. Under low-salinity stress conditions, 50 crabs were transferred to 10% salinity artificial seawater, and the gills of five crabs were randomly sampled at each of the following time points: 0, 3, 9, 12, 24, 36, and 48 h. Tissues were collected and stored at – 80 °C. The remaining 50 crabs in 26% salinity seawater were sampled at the same time points (n = 5 crabs/time point) as a control group for the reference sample.

For bacterial challenge experiments, V. alginolyticus was inoculated into marine broth 2216E at 28.5 °C and collected by 3000 g centrifugation for 10 min. The pellets were resuspended in seawater to 10⁷ CFU/mL to induce significant immune responses without causing immediate mortality. Crabs (n = 50) were randomly sampled at 0, 3, 6, 12, 24, 48, and 72 h (n = 5 at each time point), and 1.5 mL of hemolymph was collected from each individual in the control and challenged groups. The hemolymph was centrifuged in order to collect hemocytes (2000 g for 10 min at 4 °C), and the RNA of the hemocyte pellets was extracted immediately. Hemocytes from crabs in the control group were used as reference samples.

RNA isolation and cDNA synthesis

An RNAiso Plus kit (TaKaRa, Dalian, China) was used to extract total RNA. The Promega M-MLV RT (Promega, Durham, NM, USA) was used for cDNA first-strand synthesis, and DNase Ι (Promega) was used to treat total RNA used as the template. Single-stranded cDNA was synthesized from total RNA (1 μg) in a final volume of 20 μL containing Tris-HCl (50 mM), random hexamers (50 pmol), RNasin (0.75 U), KCl (75 mM), DTT (50 mM), MgCl₂ (3 mM), dTTP, dGTP, dCTP, and dATP (0.2 mM, respectively), and M-MLV (200 U) reverse transcriptase (Promega). Reactions were performed at 37 °C for 1 h and terminated at 95 °C for 5 min. Products were stored at − 80 °C. A diluted cDNA mixture (1:50) was prepared for subsequent procedures.

Full-length cDNA cloning of PtAP-1

A P. trituberculatus cDNA library was constructed using the ZAP-cDNA synthesis kit and Gigapack III Gold cloning kit (Stratagene, San Diego, CA, USA). The expressed sequence tag (EST) sequences that were similar to known AP-1 sequences were identified by BLAST analysis (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The 5′ sequence of AP-1 was obtained from our preliminary transcriptome data, and the 3′ ends of AP-1 cDNA were obtained by rapid amplification of cDNA ends (RACE) based on the EST sequence and using primers listed in Table 1. Nested PCR was used to clone the 3′ end of PtAP-1 using sense primers P1 and P2 according to the SMARTer RACE cDNA amplification kit (Clontech, Santa Clara, CA, USA) according to manufacturer protocol. The PCR temperature profile was 5 min at 94 °C and 32 cycles of 30 s at 94 °C, 30 s at 60 °C, 1 min at 72 °C, and 10 min at 72 °C. The PCR products were cloned into the pMD18-T simple vector (TaKaRa) and bidirectionally sequenced, and sequencing results were verified and subjected to cluster analysis.

Table 1.

Gene-specific primers used in this study

Primer	Primer sequence (5′-3′)	Sequence information
P1	CAGGAGGTTATGGATCATGTCA	Specific primer (for RACE)
P2	AGACACGAGGCACCTTTGAACT	Specific primer (for RACE)
P3 (forward)	CGCTACACTCCAACCTCCAGTA	Specific primer (real-time PCR)
P4 (reverse)	AACCTTATCCTCCAGACGGCT	Specific primer (real-time PCR)
β-actin (forward)	TCACACACTGTCCCCATCTACG	Reference gene
β-actin (reverse)	ACCACGCTCGGTCAGGATTTTC	Reference gene

β-actin was used as a reference gene (Lu et al. 2018)

Sequence and phylogenetic analyses

The cDNA sequence of AP-1 was analyzed by BLAST, and ExPASy (http://www.expasy.org/) was used to analyze the predicted amino acid sequence. SMART software (http://smart.embl-heidelberg.de/) was used to identify characteristic domains, and FASTA (Pearson 1990) was used to calculate the identity, similarity, and gap scores. Multiple sequence alignments of AP-1 were performed using the ClustalX program (http://www.ebi.ac.uk/clustalw/), and prediction of signal peptides was performed using SignalP 3.0 software (http://www.cbs.dtu.dk/services/SignalP/) (Thompson et al. 1994). The amino acid sequence of PtAP-1 was analyzed by the neighbor-joining algorithm in Mega 3.1 (http://www.megasoftware.net/) to construct an unrooted phylogenetic tree.

Tissue distribution and PtAP-1 expression in crabs following low-salinity stress and V. alginolyticus challenge

The total RNA of hemocytes, gill, muscle, hepatopancreas, and gonad was extracted from four randomly selected crabs. RNA was isolated, and cDNA was synthesized as described. The cDNA mixture was diluted 1:100 and stored at − 80 °C.

AP-1-transcript tissue distribution and temporal-expression profiles in hemocytes challenged with V. alginolyticus and in the gill following exposure to low-salinity stress were determined by quantitative real-time PCR (qPCR). The cDNA product was amplified using AP-1-specific primers (Table 1), and the consequent PCR product was sequenced to examine the qPCR specificity. Relative AP-1 expression level was analyzed using the comparative Ct method and according to the Ct of amplified PtAP-1 and β-actin (internal control). Differences between the internal control (ΔCt) and that for the target were used to normalize the differences in qPCR efficiency and template amount. The sample ΔCt was subtracted from the calibration ΔCt value, resulting in ΔΔCt. PtAP-1 expression level was analyzed according to 2^−ΔΔCt, with the results expressed as fold difference (Livak and Schmittgen 2001). PtAP-1-transcript tissue distribution was normalized to that in the muscle.

Statistical analysis

Data were analyzed using SPSS for Windows (v22.0; IBM Corp., Armonk, NY, USA). PtAP-1 expression in different tissue and following V. alginolyticus challenge and low-salinity stress was compared using one-way analysis of variance, followed by Tukey’s multiple-comparison post hoc test. Prior to analysis, raw data were assessed for normal distributions and variance homogeneity using the Kolmogorov–Smirnov test and Levene’s test, respectively. Non-normal and heterogeneous data were transformed until normality and homogeneity were achieved. Differences were considered significant at p < 0.05.

Results

cDNA cloning and PtAP-1 structure analysis

The complete PtAP-1 cDNA sequence was 1183 bp and contained a 771-bp open reading frame encoding a 256-amino acid polypeptide with a predicted molecular mass of 28.96 kDa and a 8.90 isoelectric point (Fig. 1). SMART analysis revealed a characteristic Jun transcription factor domain (2–146 aa) and a bZIP region (177–241 aa) in the PtAP-1 sequence (Fig. 1). The deduced amino acid sequence was highly hologous to those of previously identified AP-1s (Fig. 2). AlignX analysis showed that PtAP-1 shared 59.2% identity with Litopenaeus vannamei (AIB53746), 58.7% with Macrobrachium nipponense (ASM46959), 53.4% with Hyalella azteca (XP_018022155), and 57.9% with Penaeus monodon (APL97141) (Fig. 2).

Fig. 1.

The nucleotide sequence (below) and deduced amino acid sequence (above) of PtAP-1. The nucleotide and amino acid positions are numbered on the left. The start and stop codons are in bold. The shaded amino acids indicate the predicted Jun transcription factor domain. The sequence corresponding to the basic leucine zipper domain is underlined

Fig. 2.

Multiple sequence alignment of PtAP-1 with other AP-1 variants. PtAP-1 was compared with the sequences of AP-1s from Atta cephalotes (XP_012058179), Trachymyrmex septentrionalis (XP_018357058), Atta colombica (KYM80865), Acromyrmex echinatior (XP_011069320), Trachymyrmex cornetzi (XP_018363574), Wasmannia auropunctata (XP_011694334), Cyphomyrmex costatus (XP_018394503.1), Vollenhovia emeryi (XP_011874216), Solenopsis invicta (XP_011165845), Pogonomyrmex barbatus (XP_011639737), Lasius niger (KMQ96686), Camponotus floridanus (XP_011259614.1), Ooceraea biroi (XP_019886697), Zootermopsis nevadensis (XP_021915872), Nilaparvata lugens (XP_022197425), Litopenaeus vannamei (AIB53746), Penaeus monodon (APL97141), Macrobrachium nipponense (ASM46959), and Hyalella azteca (XP_018022155). The black-shaded regions indicate identical amino acids among the different sequences, whereas the gray-shaded regions represent conserved replacements. The bZIP domain is indicated by asterisks (*), and gaps are indicated by dashes

Phylogenetic analysis of PtAP-1

The neighbor-joining method was applied to construct a phylogenetic tree in order to evaluate relationships between PtAP-1 and other AP-1s in molecular evolution. AP-1 members fell into two groups based on their vertebrate and invertebrate origins (Fig. 3). PtAP-1 primarily clustered with AP-1 from shrimp and formed a sister group with that from insects.

Fig. 3.

Phylogenetic tree constructed using the neighbor-joining method. Common names and GenBank accession numbers are as follows: Litopenaeus vannamei (AIB53746), Penaeus monodon (APL97141), Macrobrachium nipponense (ASM46959), Zootermopsis nevadensis (XP_021915872), Hyalella azteca (XP_018022155), Lasius niger (KMQ96686), Vollenhovia emeryi (XP_011874216), Trachymyrmex cornetzi (XP_018363574), Cyphomyrmex costatus (XP_018394503.1), Ooceraea biroi (XP_019886697), Atta cephalotes (XP_012058179), Acromyrmex echinatior (XP_011069320), Atta colombica (KYM80865), Camponotus floridanus (XP_011259614.1), Trachymyrmex septentrionalis (XP_018357058), Pogonomyrmex barbatus (XP_011639737), Nilaparvata lugens (XP_022197425), Wasmannia auropunctata (XP_011694334), and Solenopsis invicta (XP_011165845). Numbers next to the branches indicate bootstrap values for each internal branch in tree nodes from 1000 replicates

Tissue distribution of PtAP-1 and the temporal-expression profile of PtAP-1 in response to low-salinity and bacterial challenge

PtAP-1-transcript expression was mainly detected in the gonad and to a much lesser degree in the hepatopancreas, gill, muscle, and hemocytes (Fig. 4). PtAP-1-transcript levels in the gill following low-salinity challenge were quantified with qPCR. During the first 6 h, PtAP-1 mRNA levels remained constant, whereas expression levels were significantly upregulated at 12 h, resulting in a 2.5-fold increase relative to levels detected in the control group (P < 0.05) (Fig. 5). Subsequently, PtAP-1-transcript expression levels decreased relative to those detected at 12 h, followed by their restoration to baseline levels at 48 h. There were no significant changes in PtAP-1 expression during the early stages of V. alginnolyficus challenge (0–3 h) (Fig. 6). At 6 h, we observed significant upregulation of PtAP-1 expression, reaching a peak from 6 to 48 h; however, from 48- to 72-h post-challenge, PtAP-1 expression was downregulated (Fig. 6).

Fig. 4.

PtAP-1-transcript levels in hemocytes, muscle, hepatopancreas, gill, and gonad. Each symbol and vertical bar represent the mean ± standard error (n = 4). Data designated by different letters showed significant differences (P < 0.05) among different tissues

Fig. 5.

Temporal expression of PtAP-1 in the gill after low-salinity challenge at 0, 3, 9, 12, 24, 36, and 48 h. PtAP-1 mRNA level was normalized against the control group, with β-actin used as the internal control in order to calibrate cDNA-template levels for all samples. Each bar represents the mean ± standard error (n = 5 individuals). Data for the same challenge time point with different letters indicate significant differences (P < 0.05) among different time points or groups

Fig. 6.

Temporal expression of PtAP-1 in hemocytes after Vibrio alginnolyficus challenge at 0 h, 3 h, 6 h, 12 h, 24 h, 48 h, and 72 h. Each bar represents the mean ± standard error (n = 5 individuals). Data for the same challenge time point with different letters indicate significant differences (P < 0.05) among different time points or groups

Discussion

In this study, we characterized the AP-1 gene from the swimming crab P. trituberculatus. Jun proteins, as AP-1 subunits, contain a basic DNA-binding domain, a C-terminal leucine zipper domain for dimerization, and an N-terminal transcriptional activation domain (Sun and Oberley 1996). We found a characteristic Jun transcription factor domain (2–146 aa) and a bZIP region (177–241 aa) in the PtAP-1 sequence (Fig. 1), although a signal peptide was not found, indicating that PtAP-1, similar to other AP-1s, is not a secreted protein. Multiple sequence alignment revealed a degree of conservation among AP-1s in the PtAP-1 C-terminus along with considerable variability in the N-terminal domain (Fig. 2). Though limited sequences conservation was found in Jun domain located in the N-terminus, a relatively high degree of sequence similarity was found in the bZIP domain among AP-1s (Fig. 2). Phylogenetic analysis of PtAP-1 showed that it primarily clustered with AP-1s from shrimp and formed a sister group with that of insects (Fig. 3). These findings suggested that PtAP-1 is a new member of the AP-1 family.

Analysis of tissue-specific expression revealed the highest PtAP-1 expression in the gonad, indicating PtAP-1 involvement in reproductive regulation, given the importance of this organ for reproduction in shrimps and crabs (Fig. 4). Similar to crabs, we previously reported that amphioxus AP-1 participates in ovary development (Tan 2012). Therefore, the abundance of PtAP-1 transcripts in the gonad indicated its likely involvement in cell proliferation.

AP-1 is involved in differentiation, inflammation, apoptosis, wound healing, and cellular migration (Tuvikene et al. 2016). c-Jun N-terminal kinase, which regulates Jun protein activity and expression, also functions in response to environmental stress (Wagner and Nebreda 2009; Badshah et al. 2016). The optimal salinity level for P. trituberculatus is 25%, whereas salinity levels < 10% or > 40% represent stress conditions that negatively affect growth (Lu et al. 2012). In the present study, PtAP-1 levels in the gill following low-salinity challenge were significantly upregulated at 12 h, showing a 2.5-fold increase relative to levels detected in controls (P < 0.05) (Fig. 5). These findings suggested that PtAP-1 might participate in ion-transport processes by regulating the expression of related proteins.

AP-1 regulates the cell survival and apoptosis to protect organisms and activates the downstream immune responses (De et al. 2003). Activation of PtAP-1 is necessary to initiate immune responses, whereas strict regulation of this activity is critical to prevent detrimental effects to the host resulting from prolonged AP-1 activation (Papoudou-Bai et al. 2016). In the present study, PtAP-1 did not respond to bacterial infection during this period (Fig. 6). We speculate that the absence of a response might be because PtAP-1 is a transcription factor rather than a pattern-recognition receptor for bacteria. The significant upregulation of PtAP-1 expression at 6 h post-challenge indicated initiation of a response to bacterial infection. Subsequently, hemocytes produced by PtAP-1 were recruited to augment the infiltrating hemocytes and prevent potential damage to other tissues, as well as to upregulate PtAP-1 expression, which peaked from 6 to 48 h (Zhao et al. 2010). PtAP-1 plays an important role in the immune response induced by bacterial challenge, during which hemocytes replicate rapidly, and the immune system is activated. Here, during the post-challenge stage, PtAP-1 expression was downregulated, although these levels remained significantly higher than those detected at baseline (Fig. 6), suggesting that PtAP-1 functions during later stages of infection. These results suggested the involvement of PtAP-1 in the immune responses and osmoregulation of crustaceans.

Conclusion

In this study, we identified AP-1 from P. trituberculatus, with the structure of PtAP-1 suggesting that it could be a new member of the AP-1 family. Our results showed that PtAP-1 was most abundantly expressed in gonad tissue, functions in later stages of responses to bacterial infection, and might regulate proteins involved in ion-transport processes.

Authors’ contributions

C Wang and CK Mu conceived and designed the study. H Wang and MY Kong performed the cultivation of experimental animals. H Wang, C Shi, MY Kong, C Mu, and HL Wei performed and analyzed all the other experiments. H Wang and C Shi wrote the manuscript with support from all authors. All authors read and approved the final manuscript.

Funding

This study was sponsored by the National Natural Science Foundation of China (41476124), China Postdoctoral Science Foundation (2018M632439), Ningbo university research fund (XYL18013), and K.C. Wong Magna Fund in Ningbo University.

Competing interests

The authors declare that they have no competing interests.

Ethics approval and consent to participate

The animal subjects used in the present study are crabs, which are invertebrates and are exempt from this requirement.

Consent for publication

Not applicable.