Skip to main content
Ecology and Evolution logoLink to Ecology and Evolution
. 2018 Oct 3;8(21):10587–10593. doi: 10.1002/ece3.4545

DNA barcoding the flowering plants from the tropical coral islands of Xisha (China)

Shengchun Li 1,2, Xin Qian 1,2, Zexin Zheng 3, Miaomiao Shi 1, Xiaoyu Chang 1, Xiaojuan Li 1,2, Junfang Liu 1,2, Tieyao Tu 1,, Dianxiang Zhang 1
PMCID: PMC6238132  PMID: 30464830

Abstract

Aim

DNA barcoding has been widely applied to species diversity assessment in various ecosystems, including temperate forests, subtropical forests, and tropical rain forests. However, tropical coral islands have never been barcoded before due to the difficulties in field exploring. This study aims at barcoding the flowering plants from a unique ecosystem of the tropical coral islands in the Pacific Ocean and supplying valuable evolutionary information for better understanding plant community assembly of those particular islands in the future.

Location

Xisha Islands, China.

Methods

This study built a DNA barcode database for 155 plant species from the Xisha Islands using three DNA markers (ITS, rbcL, and matK). We applied the sequence similarity method and a phylogenetic‐based method to assess the barcoding resolution.

Results

All the three DNA barcodes showed high levels of PCR success (96%–99%) and sequencing success (98%–100%). ITS performed the highest rate of species resolution (>95%) among the three markers, while plastid markers delivered a relatively poor species resolution (85%–90%). Our analyses obtained a marginal increase in species resolution when combining the three DNA barcodes.

Main conclusions

This study provides the first plant DNA barcode data for the unique ecosystem of tropical coral islands and considerably supplements the DNA barcode library for the flowering plants on the oceanic islands. Based on the PCR and sequencing success rates, and the discriminatory power of the three DNA regions, we recommend ITS as the most successful DNA barcode to identify the flowering plants from Xisha Islands. Due to its high sequence variation and low fungal contamination, ITS could be a preferable candidate of DNA barcode for plants from other tropical coral islands as well. Our results also shed lights on the importance of biodiversity conservation of tropical coral islands.

Keywords: biodiversity conservation, community assembly, DNA barcode, Pacific Ocean, South China Sea, species identification

1. INTRODUCTION

The primary application of DNA barcoding is to identify unknown samples, and the emergence of DNA barcoding has greatly promoted the survey of biodiversity (Gregory, 2005). DNA barcoding has been particularly valuable in the inventorying of biodiversity hotspots. Successful investigations have been carried out in Mount Kinabalu, Malaysia (Merckx et al., 2015), and Ontario, Canada (Telfer et al., 2015), providing a convenient and efficient way for recognition of nature in these regions. DNA barcoding can also be a powerful tool for addressing fundamental questions in ecology, evolution, and conservation biology (Kress, García‐Robledo, Uriarte, & Erickson, 2015). A considerable number of cryptic and new species have been discovered based on evidence from DNA barcodes (García‐Robledo, Kuprewicz, Staines, Kress, & Erwin, 2013; Hamsher & Saunders, 2014; Hebert, Penton, Burns, Janzen, & Hallwachs, 2004; Silva, de Abreu, Orlando, Wisniewski, & Santos‐Wisniewski, 2014; Smith et al., 2012; Winterbottom, Hanner, Burridge, & Zur, 2014). DNA barcoding data prodigiously contribute to understanding the evolutionary relations within a given community (Kress, et al., 2009). As molecular information makes the interpretation of phylogenetic relationships easier and more reliable (Webb, Ackerly, McPeek, & Donoghue, 2002), DNA barcoding data could also be useful in plant community ecology concerning the relationships among coexisting species. Since its recent consummation, the DNA barcoding library has become a standard metric for biological conservation assessment (Faith, 1992, 2008 ; Forest, et al., 2007). DNA sequence data provide an evolutionary dimension to diversity estimates, which is of great value to compare diversity and establish protected areas across the landscape (Kress et al., 2015).

The development of sequencing technologies and their broad usage in species identification, biodiversity assessment, and ecological researches have greatly promoted the studies in DNA barcoding. During the last 15 years, scientists have published more than 3,000 papers on plant DNA barcoding–covering different vegetation types in different climate zones, including arctic flora of Canada (Kuzmina, Johnson, Barron, & Hebert, 2012; Saarela, Sokoloff, Gillespie, Consaul, & Bull, 2013), northern temperate forests (Burgess et al., 2011; Fazekas et al., 2008), subtropical forests of China (Liu et al., 2015), and tropical forests in the Old World as well as the New World (Costion et al., 2011; Kress et al., 2009; Parmentier et al., 2013).

Tropical coral islands represent a unique ecosystem: (a) They are far away from continental ecological systems with clear oceanic boundaries; (b) Their species composition could be very different from those of the mainland; (c) They often represent small geographical areas, where the species pool may come either from closely related species or from distantly related clades; (d) They are of particular conservation and scientific interests in the global inventory of biodiversity (Monaghan, Balke, Pons, & Vogler, 2006), and they badly need a comprehensive understanding on biodiversity and ecology due to the increasingly anthropogenic disturbance.

The flora of tropical oceanic islands has rarely been studied so far. The extreme difficulties of plant exploring and sampling from these areas might be the major limiting factors. The high cost of exploring these islands, combined with unstable weather condition, also contributes to the poor knowledge concerning their plant biodiversity. Although both the Chinese version Flora Reipublicae Popularis Sinicae (FRPS) (1959–2004) and the English version Flora of China were fully compiled (Wu, Raven, & Hong, 1994–2013), the collections of plant specimens from the oceanic islands are still rare. Of the ca. 1 million plant specimens in the herbarium of South China Botanical Garden (IBSC), which hosts specimens mainly from southern China, only 2,643 collections are from the ca. 6,500 oceanic islands of China (excluding Hainan Island and Taiwan Island) from 1927 to 2013.

Xisha Islands are a group of tropical oceanic coral islands with ca. 25 small islets in the South China Sea and are about 330 km apart from Hainan Island. Xisha Islands with a total land area of ca. 7.6 km2 are very distinctive from other ecosystems in China, including mainland China, as well as the many continental islands and the oceanic volcanic islands. The soil of Xisha Islands is basically made of phospho calcic soil and coastal saline soil that developed from coral and shell remnants, and is often dominant with salt‐tolerant plant species. Plants on these islands may also be highly constrained by extreme physical components of the environment, such as high temperature, strong solar radiation, and severe wind and drought stress. As a result, Xisha Islands harbor a number of plant species that are rarely recorded in mainland China or on the many continental islands, especially the dominant species such as Suriana maritima L. (Surianaceae), Pemphis acidula J.R. Forst. & G. Forst. (Lythraceae), Guettarda speciosa L. (Rubiaceae), Scaevola taccada (Gaertn.) Roxb. (Goodeniaceae), Pisonia grandis R. Br. (Nyctaginaceae), and Tournefortia argentea L. f. (Boraginaceae) (Tong, Jian, Chen, Li, & Xing, 2013) (Figure 1).

Figure 1.

Figure 1

Typical plants on Xisha Islands. (a) Suriana maritima L.; (b) Pemphis acidula J. R. Forst. & G. Forst.; (c) Tournefortia argentea L. f.; (d) Pisonia grandis R. Br.

Since 2014, we have explored the flora of 19 islands of the Xisha Islands and conducted a comprehensive plant sampling by species through different seasons. Using the technology of DNA barcoding, we would like to provide a particular case study of plant DNA barcoding in this unique flora. Totally, we tested three DNA regions (ITS, rbcL, and matK) for 155 species in 120 genera of 42 families representing nearly all native plant species from Xisha Islands. Phylogenetic relations among species can help reconstruct evolutionary relationships within communities and allow people to infer how the biodiversity has come about (Pagel, 1999). Unfortunately, the full diversity of species in most regions is still unknown and information on the DNA sequences is extremely poor, so that understanding the mechanisms of maintaining biodiversity patterns has remained elusive (Purvis & Hector, 2000). Our study filled the gap on the barcode library from tropical coral islands in the Pacific Ocean and recovered the lineage relationships for this unique flora. Our study provides a precise snapshot of plant biodiversity in tropical oceanic coral islands, and the DNA sequence data could contribute to comprehensively understanding biodiversity patterns of island floras in future studies.

2. METHODS

2.1. Taxon sampling and data collection

We conducted our field work for the DNA samples on the Xisha Islands from 2014 to 2017. We sampled 312 individuals representing 155 species in 120 genera of 42 angiosperm families, of which 132 species have been sampled at least twice. Considering that there is little intraspecific variation due to the similar geography and climate conditions, we only sampled two individuals of most species. We sampled individuals of the same species from different islands as far as possible to guarantee that the two individuals represent distinct lineages. We also explored the islands at both dry and wet seasons to make sure that the samples bear flowers and fruits, and thus can be correctly identified based on morphology. All the voucher specimens were deposited at Herbarium of the South China Botanical Garden (IBSC). A list of the plant samples and the GenBank accessions are provided in Supporting Information Table S1.

2.2. DNA extraction, PCR, and sequencing

Total plant DNA was extracted from dried leaves preserved through silica gel desiccation using the CTAB method (Doyle & Doyle, 1987). We selected two plastid DNA regions rbcL, matK, and the nuclear ribosomal internal transcribed spacer (ITS) for routine PCR. The PCR amplification for plastid DNA regions used an initial predenaturation step at 94°C for 5 min, followed by 35 cycles of denaturing for 1 min at 94°C, primer annealing for 30 s at 52°C, and elongation step for 1 min at 72°C, with a final 8 min elongation step at 72°C. The PCR cycling condition of ITS was the same as the plastid DNA, except for primer annealing at 53°C. All samples were sequenced directly in both directions using the same PCR primers. Details on the primer pairs used for amplifying each locus are provided in Table 1.

Table 1.

Primer pairs for three DNA barcode regions: rbcL, matK, and ITS

Marker Primer Sequence(5′−3″) References
rbcL 1F ATGTCACCACAAACAGAAAC Fay, Swensen, and Chase (1997)
1379R GCAGCTAATTCAGGACTCC Little and Barrington, (2003)
matK KIM 3F CGTACAGTACTTTTGTGTTTACGAG K. J. Kim, unpublished
KIM 1R ACCCAGTCCATCTGGAAATCTTGGTTC K. J. Kim, unpublished
390F CGATCTATTCATTCAATATTTC Cuénoud et al. (2002)
1326R TCTAGCACACGAAAGTCGAAGT Cuénoud et al. (2002)
Kew xF TAATTTACGATCAATTCATTC Ford, Ayres, Toomey, and Liu (2009)
Kew 5R GTTCTAGCACAAGAAAGTCG Ford et al. (2009)
ITS N‐nc18s10 F AGGAGAAGTCGTAACAAG Suh, Thien, Reeve, and Zimmer (1996), Wen and Zimmer, (1996)
C26A R GTTTCTTTTCCTCCGCT Suh et al. (1996)

2.3. Data analyses

Sequences were assembled using SEQUENCHER 5.3 (Gene Codes Corporation 2015) and aligned with Geneious 8.1.7 (https://www.geneious.com, Kearse et al., 2012). The plastid DNA markers rbcL and matK were easily aligned using MAFFT alignment in Geneious. The ITS sequences were first aligned automatically via Geneious for all samples, then we retained three parts of conservative sequences for all samples, the remaining parts of variant sequences were partitioned by families. We applied two analytical methods to assess the barcoding resolution, the sequence similarity method (BLASTn searches) and a phylogenetic‐based method. BLASTn method (Altschul, Gish, Miller, Myers, & Lipman, 1990) was operated through BLAST+2.6.0 in which the sequence was correctly determined when that species has the highest Bit‐Score among all candidates.

Phylogenetic tree based on maximum parsimony (MP) algorithms was reconstructed in PAUP* 4.0b10 (Swofford, 2000). We reconstructed phylogenies both for the three markers independently and for their combinations. The supports of nodes were assessed on the basis of 500 bootstrap replicates. Species were considered resolved if a group of samples representing a species were recovered as monophyly with a bootstrap value that exceeded 70% (Theodoridis et al., 2012).

3. RESULTS

3.1. PCR and sequencing success rates

The PCR and the sequencing success rates were generally high for the three regions. rbcL exhibited the highest amplification success rate (99%), followed by matK (97%) and ITS (96%). Similarly, rbcL could be successfully sequenced for all individuals, while matK and ITS were for 99% and 98%, respectively. In total, we obtained 902 sequences from 312 individuals of 155 species, including 309 individuals of 154 species for rbcL, 299 individuals of 152 species for matK, 294 individuals of 148 species for ITS (Table 2).

Table 2.

PCR and sequencing success of different DNA barcode regions for 155 flowering plants on Xisha Islands

Marker PCR success (%) Sequencing success (%) Sequences (species)
rbcL 99 100 309 (154)
matK 97 98 299 (152)
ITS 96 98 294 (148)

3.2. Species discrimination

Our results showed that the two analytical methods performed similar trends among the three barcodes. BLASTn analysis provided the highest success rate of species‐level resolution with ITS (95%), followed by matK (87%), and then rbcL (85%) (Table 3). All markers delivered 100% correct assignments to genus and family. We assessed the discriminatory power of each DNA barcode by evaluating the percentage monophyly of each species using MP trees (Figure 2). Of the single marker analyses, all the three DNA barcodes showed high rates of species resolution. ITS was the most successful at the species‐level resolution (96%), while rbcL and matK resolved 87% and 89% of species, respectively. In addition, the combination of rbcL + ITS (97%) and matK + ITS (97%) resulted in the highest rate of species resolution, followed by rbcL + matK (92%). The three‐barcode combination (rbcL + matK + ITS) (97%) did not improve species resolution compared to the two‐barcode combination of ITS with either rbcL or matK. The families Poaceae, Fabaceae, Asteraceae, Euphorbiaceae, and Malvaceae each had more than 10 species. The genus Sida L. of Malvaceae had seven species, and the genera Ipomoea L. (Convolvulaceae), Euphorbia L. (Euphorbiaceae), and Digitaria Hall. (Poaceae) each had five species. ITS showed higher rates of species identification in these large families and genera than rbcL or matK except in Digitaria. The three DNA barcodes alone and their combination all showed poor species resolution in Digitaria.

Table 3.

BLAST results of species resolution for the three DNA barcode regions

Taxonomic rank Frequency of correct identification (BLAST)%
rbcL matK ITS
Species 84 86 95
Genus 100 100 100

Figure 2.

Figure 2

Species resolution for three DNA barcode regions and their combinations using phylogenetic‐based method

4. DISCUSSION

Primer universality and species identification are two crucial criterions for an ideal DNA barcode. The three DNA barcodes showed high rates of amplification and sequencing successes, among which rbcL had the best performance of universality. For matK, three pairs of primers were used due to the lack of universal primers for the broad plant taxa (Costion et al., 2011; Kress, Wurdack, Zimmer, Weigt, & Janzen, 2005; Parmentier et al., 2013). Additionally, we failed to obtain 13 matK sequences, of which 46% belongs to Poales. ITS showed an excellent universality (PCR success rate: 96%; sequencing success rate: 98%), and the fungal contamination was detected in only seven samples (2.2%) of 312 individuals.

Two analytical methods both showed that the three barcodes alone could identified>85% species and ITS performed the best. In the tree‐based method, the combination of ITS and the plastid DNA barcodes did not get a better species resolution than the single ITS barcode, while the combination of two plastid DNA barcodes got even lower species resolution than ITS. Each of the MP trees had considerably high terminal branch supports. Generally, nuclear DNA (nrDNA) evolves rapidly and possesses more variations that can differentiate closely related species (Kress, et al., 2005; Nieto Feliner & Rosselló, 2007; Sass, Little, Stevenson, & Specht, 2007). Plastid DNA region (such as rbcL and matK) is more conservative than nrDNA region (such as ITS). Either rbcL or matK can well resolve the taxa at genus level or above but does not work well among closely related species or within species‐rich genera.

To date, thousands of DNA barcoding studies have been carried out on different spatial scales of species pool and various combinations of different loci have been suggested as their preferred barcodes. A number of DNA barcodes from plastid genome have been proposed based on the considerable universality and relatively high discriminatory power (Burgess et al., 2011; CBOL, 2009; Fazekas et al., 2008; Kress & Erickson, 2007; Kress et al., 2009; Parmentier et al., 2013; Pei et al., 2015). In some cases, however, it is especially difficult to distinguish closely related species with plastid DNA barcodes. ITS has been commonly used in plant molecular systematic investigations owing to a high rate of species resolution (Alvarez & Wendel, 2003; Chen et al., 2010; Kress et al., 2005; Li et al., 2011; Yao et al., 2010), but has not been widely applied in DNA barcoding studies because of several limitations: incomplete evolutionary history, fungal contamination, and poor primer universality (Hollingsworth, Graham, & Little, 2011). It could be difficult to be amplified and sequenced from diverse samples because of fungal contamination and divergent paralogue copies caused by incomplete concerted evolution of ITS (Baldwin et al., 1995; Cullings & Vogler, 1998; Hollingsworth et al., 2011; Zhang, Wendel, & Clark, 1997). In this study, our results indicated that ITS could be a better choice for barcoding the flora of the tropical coral islands of Xisha compared to rbcL and matK. First, ITS showed outstanding primer universality. The flora of Xisha Islands is mainly composed of herbs (78%) and lianas (11%) (Figure 3). The primer universality of ITS in our study (94%) is much higher than in the study of 285 tropical trees reported by Gonzalez et al. (2009) (41%) and a sample of 531 woody species published by Liu et al. (2015) (73%). The domination by herbs and lianas on Xisha Islands might contribute to the high primer universality. Second, endophytic fungi are considered to have a great effect on plant DNA barcoding when using ITS in different ecosystems (Hollingsworth et al., 2011). However, the fungal contamination could be much lower in the vegetation of the tropical coral islands than in other vegetations. In this study, only seven species (2.2%) were detected with fungal contamination of ITS. Finally, we analyzed the taxonomic structure of plants on Xisha Islands. Interestingly, the genera/species (77%) and monotypic genera/genera (86%) ratios are extraordinarily high (Figure 4). Among the 42 families and 120 genera from Xisha Islands in this study, 20 families and 103 genera contain only one species. Therefore, the generally far genetic distances among lineages from the Xisha Islands may interpret why all three DNA barcodes alone have a high rate of species identification. ITS showed a higher rate of species identification in groups with richer species diversity than rbcL or matK except for Digitaria, of which the five species are morphologically similar and very difficult to be distinguished. Specific DNA barcodes or genomic data may be required to distinguish such closely related species. Considering the trade‐off between primer universality and species discriminatory power, we recommend ITS as the DNA barcode for the flowering plants of Xisha Islands and other oceanic coral islets. This study provides the first DNA barcode data of the flora from the tropical oceanic coral islands. The results indicate that ITS shows the highest rate of species resolution for single DNA barcode with an excellent primer universality. ITS could be the best choice for barcoding the flowering plants from Xisha Islands since the three‐barcode combination (rbcL + matK + ITS) didn't significantly improve the species resolution. However, the two plastid markers could be informative in addressing questions regarding community ecology and the evolutionary relations among community members. The two plastid markers could also help people to understand the relationships of co‐occurring species and the species assembly within community when combining more information including species abundance on each island and the functional traits of all the species in the future. In addition, the taxonomic structure of flowering plants on Xisha Islands indicates that biodiversity loss could be more likely to happen on tropical coral islands. As a result, we need to pay more attention to the biodiversity conservation in this unique ecosystem. The nucleotide information of the dominant or constructive species (such as Suriana maritima, Guettarda speciose, Pisonia grandis) and the rare and endangered species (such as Pemphis acidula, Eulophia graminea Lindl. [Orchidaceae]) in this study may be of significance for ecological restoration and species conservation.

Figure 3.

Figure 3

Four types of life forms and their proportion of flowering plants on Xisha Islands

Figure 4.

Figure 4

The taxonomic structure of flowering plants on Xisha Islands

CONFLICT OF INTEREST

None declared.

AUTHOR CONTRIBUTIONS

T.T., D.Z, and S.L. conceived the ideas; T.T., S.L., X.Q., X.C., X.L., and J.L. conducted the flora exploring and taxa sampling; S.L. and Z.Z performed the experiments of PCR, and S.L. analyzed the data; S.L. wrote the first draft of the manuscript; S.L., M.S., T.T., and D.Z. contributed to finalizing of the manuscript.

DATA ACCESSIBILITY

A list of the plant samples and their GenBank accession details are provided in Supporting Information Table S1.

Supporting information

 

Li S, Qian X, Zheng Z, et al. DNA barcoding the flowering plants from the tropical coral islands of Xisha (China). Ecol Evol. 2018;8:10587–10593. 10.1002/ece3.4545

REFERENCES

  1. Altschul, S. F. , Gish, W. , Miller, W. , Myers, E. W. , & Lipman, D. J. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215, 403–410. 10.1016/S0022-2836(05)80360-2 [DOI] [PubMed] [Google Scholar]
  2. Alvarez, I. , & Wendel, J. F. (2003). Ribosomal ITS sequences and plant phylogenetic inference. Molecular Phylogenetics and Evolution, 29, 417–434. 10.1016/S1055-7903(03)00208-2 [DOI] [PubMed] [Google Scholar]
  3. Baldwin, B. G. , Sanderson, M. J. , Porter, J. M. , Wojciechowski, M. F. , Campbell, C. S. , & Donoghue, M. J. (1995). The ITS region of nuclear ribosomal DNA: A valuable source of evidence on angiosperm phylogeny. Annals of the Missouri Botanical Garden, 82, 247–277. 10.2307/2399880 [DOI] [Google Scholar]
  4. Burgess, K. S. , Fazekas, A. J. , Kesanakurti, P. R. , Graham, S. W. , Husband, B. C. , Newmaster, S. G. , … Barrett, S. C. H. (2011). Discriminating plant species in a local temperate flora using the rbcL + matK DNA barcode. Methods in Ecology and Evolution, 2(4), 333–340. 10.1111/j.2041-210X.2011.00092.x [DOI] [Google Scholar]
  5. CBOL Plant Working Group (2009). A DNA barcode for land plants. Proceedings of the National Academy of Sciences of the United States of America, 106(31), 12794–12797. 10.1073/pnas.0905845106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen, S. , Yao, H. , Han, J. , Song, J. , Zhu, Y. , Ma, X. , … Leon, C. (2010). Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS One, 5, e8613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Costion, C. , Ford, A. , Cross, H. , Crayn, D. , Harrington, M. , & Lowe, A. (2011). Plant DNA barcodes can accurately estimate species richness in poorly known floras. PLoS One, 6(11), e26841 10.1371/journal.pone.0026841 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cuénoud, P. , Savolainen, V. , Chatrou, L. W. , Powell, M. , Grayer, R. J. , & Chase, M. W. (2002). Molecular phylogenetics of Caryophyllales based on nuclear 18S rDNA and plastid rbcL, atpB, and matK DNA sequences. American Journal of Botany, 89, 132–144. 10.3732/ajb.89.1.132 [DOI] [PubMed] [Google Scholar]
  9. Cullings, K. W. , & Vogler, D. R. (1998). A 5.8S nuclear ribosomal RNA gene sequence database. Molecular Ecology, 7, 919–923. [DOI] [PubMed] [Google Scholar]
  10. Doyle, J. , & Doyle, J. (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin, 19, 11–15. [Google Scholar]
  11. Faith, D. P. (1992). Conservation evaluation and phylogenetic diversity. Biological Conservation, 61, 1–10. 10.1016/0006-3207(92)91201-3 [DOI] [Google Scholar]
  12. Faith, D. P. (2008). Phylogenetic diversity and conservation In Carroll S. P., & Fox C. (Eds.), Conservation biology: Evolution in action (pp. 99–115). New York, NY: Oxford University Press Inc. [Google Scholar]
  13. Fay, M. F. , Swensen, S. M. , & Chase, M. W. (1997). Taxonomic affinities of Medusagyne oppositifolia (Medusagynaceae). Kew Bulletin, 52, 111–120. 10.2307/4117844 [DOI] [Google Scholar]
  14. Fazekas, A. J. , Burgess, K. S. , Kesanakurti, P. R. , Graham, S. W. , Newmaster, S. G. , Husband, B. C. , … Barrett, S. C. H. (2008). Multiple multilocus DNA barcodes from the plastid genome discriminate plant species equally well. PLoS One, 3(7), e2802 10.1371/journal.pone.0002802 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ford, C. S. , Ayres, K. L. , Toomey, N. , & Liu, C. (2009). Selection of candidate coding DNA barcoding regions for use on land plants. Botanical Journal of the Linnean Society, 159, 1–11. [Google Scholar]
  16. Forest, F. , Grenyer, R. , Rouget, M. , Davies, J. , Cowling, R. M. , Faith, D. P. , … Savolainen, V. (2007). Preserving the evolutionary potential of floras in biodiversity hotspots. Nature, 445, 757–760. 10.1038/nature05587 [DOI] [PubMed] [Google Scholar]
  17. García‐Robledo, C. , Kuprewicz, E. K. , Staines, C. L. , Kress, W. J. , & Erwin, T. L. (2013). Using a comprehensive DNA barcode library to detect novel egg and larval host plant associations in Cephaloleia rolled‐leaf beetles (Coleoptera: Chrysomelidae). Biological Journal of the Linnean Society, 110, 189–198. [Google Scholar]
  18. Gonzalez, M. A. , Baraloto, C. , Engel, J. , Mori, S. A. , Pétronelli, P. , Riéra, B. , … Chave, J. (2009). Identification of Amazonian trees with DNA barcodes. PLoS One, 4(10), e7483 10.1371/journal.pone.0007483 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Gregory, T. R. (2005). DNA barcoding does not compete with taxonomy. Nature, 434, 1067. [DOI] [PubMed] [Google Scholar]
  20. Hamsher, S. E. , & Saunders, G. W. (2014). A floristic survey of marine tube‐forming diatoms reveals unexpected diversity and extensive co‐habitation among genetic lines of the Berkeleya rutilans complex (Bacillariophyceae). European Journal of Phycology, 49, 47–59. [Google Scholar]
  21. Hebert, P. D. N. , Penton, E. H. , Burns, J. M. , Janzen, D. H. , & Hallwachs, W. (2004). Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator . Proceedings of the National Academy of Sciences of the United States of America, 101, 14812–14817. 10.1073/pnas.0406166101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hollingsworth, P. M. , Graham, S. W. , & Little, D. P. (2011). Choosing and using a plant DNA barcode. PLoS One, 6, e19254 10.1371/journal.pone.0019254 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kearse, M. , Moir, R. , Wilson, A. , Stones‐Havas, S. , Cheung, M. , Sturrock, S. , … Drummond, A. (2012). Geneious basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 28(12), 1647–1649. 10.1093/bioinformatics/bts199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kress, W. J. , & Erickson, D. L. (2007). A two–locus global DNA barcode for land plants: The coding rbcL gene complements the non–coding trnH–psbA spacer region. PLoS One, 2(6), e508 10.1371/journal.pone.0000508 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kress, W. J. , Erickson, D. L. , Jones, F. A. , Swenson, N. G. , Perez, R. , Sanjur, O. , & Bermingham, E. (2009). Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. Proceedings of the National Academy of Sciences of the United States of America, 106(44), 18621–18626. 10.1073/pnas.0909820106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kress, W. J. , García‐Robledo, C. , Uriarte, M. , & Erickson, D. L. (2015). DNA barcodes for ecology, evolution, and conservation. Trends in Ecology & Evolution, 30, 25–35. 10.1016/j.tree.2014.10.008 [DOI] [PubMed] [Google Scholar]
  27. Kress, W. J. , Wurdack, K. J. , Zimmer, E. A. , Weigt, L. A. , & Janzen, D. H. (2005). Use of DNA barcodes to identify flowering plants. Proceedings of the National Academy of Sciences of the United States of America, 102(23), 8369–8374. 10.1073/pnas.0503123102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kuzmina, M. L. , Johnson, K. L. , Barron, H. R. , & Hebert, P. D. (2012). Identification of the vascular plants of Churchill, Manitoba, using a DNA barcode library. BMC Ecology, 12, 25 10.1186/1472-6785-12-25 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Li, D. Z. , Gao, L. M. , Li, H. T. , Wang, H. , Ge, X. J. , Liu, J. Q. , … Duan, G. W. (2011). Comparative analysis of a large dataset indicates that internal transcribed spacer (ITS) should be incorporated into the core barcode for seed plants. Proceedings of the National Academy of Sciences of the United States of America, 108(49), 19641–19646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Little, D. P. , & Barrington, D. S. (2003). Major evolutionary events in the origin and diversification of the fern genus Polystichum (Dryopteridaceae). American Journal of Botany, 90, 508–514. 10.3732/ajb.90.3.508 [DOI] [PubMed] [Google Scholar]
  31. Liu, J. , Yan, H. F. , Newmaster, S. G. , Pei, N. C. , Ragupathy, S. , & Ge, X. J. (2015). The use of DNA barcoding as a tool for the conservation biogeography of subtropical forests in China. Diversity and Distributions, 21, 188–199. 10.1111/ddi.12276 [DOI] [Google Scholar]
  32. Merckx, V. F. T. , Hendriks, K. , Beentjes, K. , Mennes, C. , Becking, L. , Peijnenburg, K. , … Jocqué, M. (2015). Evolution of endemism on a young tropical mountain. Nature, 524, 347–350. 10.1038/nature14949 [DOI] [PubMed] [Google Scholar]
  33. Monaghan, M. T. , Balke, M. , Pons, J. , & Vogler, A. P. (2006). Beyond barcodes: Complex DNA taxonomy of a South Pacific Island radiation. Proceedings of the Royal Society of London. Series B, Biological Sciences, 273, 887–893. 10.1098/rspb.2005.3391 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Nieto Feliner, G. , & Rosselló, J. A. (2007). Better the devil you know? Guidelines for insightful utilization of nrDNA ITS in species‐level evolutionary studies in plants. Molecular Phylogenetics and Evolution, 44, 911–919. 10.1016/j.ympev.2007.01.013 [DOI] [PubMed] [Google Scholar]
  35. Pagel, M. (1999). Inferring the historical patterns of biological evolution. Nature, 401, 877–884. 10.1038/44766 [DOI] [PubMed] [Google Scholar]
  36. Parmentier, I. , Duminil, J. , Kuzmina, M. , Philippe, M. , Thomas, D. W. , Kenfack, D. , … Hardy, O. J. (2013). How effective are DNA barcodes in the identification of African rainforest trees? PLoS One, 8(4), e54921 10.1371/journal.pone.0054921 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Pei, N. C. , Erickson, D. L. , Chen, B. F. , Ge, X. J. , Mi, X. C. , Swenson, N. G. , … Kress, W. J. (2015). Closely‐related taxa influence woody species discrimination via DNA barcoding: Evidence from global forest dynamics plots. Scientific Reports, 5, 15127 10.1038/srep15127 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Purvis, A. , & Hector, A. (2000). Getting the measure of biodiversity. Nature, 405, 212–219. 10.1038/35012221 [DOI] [PubMed] [Google Scholar]
  39. Saarela, M. , Sokoloff, P. C. , Gillespie, L. J. , Consaul, L. L. , & Bull, R. D. (2013). DNA barcoding the Canadian arctic flora: Core plastid barcodes (rbcL + matK) for 490 vascular plant species. PLoS One, 8(10), e77982 10.1371/journal.pone.0077982 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Sass, C. , Little, D. P. , Stevenson, D. W. , & Specht, C. D. (2007). DNA barcoding in the Cycadales: Testing the potential of proposed barcoding markers for species identification of cycads. PLoS One, 2, e1154 10.1371/journal.pone.0001154 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Silva, E. D. , de Abreu, C. B. , Orlando, T. C. , Wisniewski, C. , & Santos‐Wisniewski, M. J. D. (2014). Alona iheringula Sinev & Kotov, 2004 (Crustacea, Anomopoda, Chydoridae, Aloninae): Life cycle and DNA barcode with implications for the taxonomy of the Aloninae subfamily. PLoS One, 9, e97050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Smith, M. A. , Fernández‐Triana, J. L. , Eveleigh, E. , Gómez, J. , Guclu, C. , Hallwachs, W. , … Ar‐Riverón, A. Z. (2012). DNA barcoding and the taxonomy of Microgastrinae wasps (Hymenoptera, Braconidae): Impacts after 8 years and nearly 20000 sequences. Molecular Ecology Resources, 13, 168–176. [DOI] [PubMed] [Google Scholar]
  43. Suh, Y. , Thien, L. B. , Reeve, H. E. , & Zimmer, E. A. (1996). Molecular evolution and phylogenetic implication of internal transcribed spacer sequences of ribosomal DNA in Winteraceae. American Journal of Botany, 80, 1042–1055. [Google Scholar]
  44. Swofford, D. L. (2000). PAUP*: Phylogenetic analysis using parsimony (*and other methods), version 4.0b. Sunderland, MA: Sinauer Associates. [Google Scholar]
  45. Telfer, A. C. , Young, M. R. , Quinn, J. , Perez, K. , Sobel, C. N. , Sones, J. E. , … deWaard, J. R. (2015). Biodiversity inventories in high gear: DNA barcoding facilitates a rapid biotic survey of a temperate nature reserve. Biodiversity Data Journal, 3, e6313 10.3897/BDJ.3.e6313 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Theodoridis, S. , Stefanaki, A. , Tezcan, M. , Aki, C. , Kokkini, S. , & Vlachonasios, K. E. (2012). DNA barcoding in native plants of the Labiatae (Lamiaceae) family from Chios Island (Greece) and the adjacent Cesme‐Karaburun Peninsula (Turkey). Molecular Ecology Resources, 12, 620–633. [DOI] [PubMed] [Google Scholar]
  47. Tong, Y. , Jian, S. G. , Chen, Q. , Li, Y. L. , & Xing, F. W. (2013). Vascular plant diversity of the Paracel Islands, China. Biodiversity Science, 21(3), 364–374. [Google Scholar]
  48. Webb, C. O. , Ackerly, D. D. , McPeek, M. A. , & Donoghue, M. J. (2002). Phylogenies and community ecology. Annual Review of Ecology and Systematics, 33, 475–505. 10.1146/annurev.ecolsys.33.010802.150448 [DOI] [Google Scholar]
  49. Wen, J. , & Zimmer, E. A. (1996). Phylogeny and biogeography of Panax L. (the Ginseng genus, Araliaceae): Inferences from ITS sequences of nuclear ribosomal DNA. Molecular Phylogenetics and Evolution, 6, 167–177. [DOI] [PubMed] [Google Scholar]
  50. Winterbottom, R. , Hanner, R. H. , Burridge, M. , & Zur, M. (2014). A cornucopia of cryptic species: A DNA barcode analysis of the gobiid fish genus Trimma (Percomorpha, Gobiiformes). ZooKeys, 381, 79–111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wu, Z. Y. , Raven, P. H. , & Hong, D. Y. (Eds.) (1994. –2013). Flora of China. Beijing, China: Science Press, and St. Louis, MO: Missouri Botanical Garden Press. [Google Scholar]
  52. Yao, H. , Song, J. , Liu, C. , Luo, K. , Han, J. , Li, Y. , … Chen, S. L. (2010). Use of ITS2 region as the universal DNA barcode for plants and animals. PLoS One, 5, e13102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zhang, W. , Wendel, J. F. , & Clark, L. G. (1997). Bamboozled again! Inadvertent isolation of fungal rDNA sequences from bamboos (Poaceae: Bambusoideae). Molecular Phylogenetics and Evolution, 8, 205–217. 10.1006/mpev.1997.0422 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

 

Data Availability Statement

A list of the plant samples and their GenBank accession details are provided in Supporting Information Table S1.


Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES